miRBase entry: bta-mir-2312

Stem-loop bta-mir-2312


Accession
MI0011329
Description
Bos taurus bta-mir-2312 precursor miRNA


Sequence

111 reads, 9 reads per million, 3 experiments
uugggcuggccaaacaguuugucuggguuauucuguaacuuggAAAACCUGAACGAACUUUUCggcccaccaa
.(((...((((.((.(((((((.((((((.(((((.....))))))))))).))))))).)).))))..))).

Structure
u   gcu    a  c       c      a     u 
 ugg   ggcc aa aguuugu uggguu uucug a
 |||   |||| || ||||||| |||||| ||||| a
 acc   ccgg UU UCAAGCA GUCCAA AAggu c
a   -ac    C  U       A      -     u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 32231536-32231608 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from bta-mir-2312
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bta-miR-2312

Accession MIMAT0011828
Description Bos taurus bta-miR-2312 mature miRNA
Sequence 44 - AAAACCUGAACGAACUUUUC - 63
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 19633723
    Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
    Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ
    PLoS One (2009) 4:e6349