WARNING: This summary was generated by AI. bta-mir-2284d, a bovine-specific microRNA, exhibits a negative correlation with various transcripts in the distal jejunum, such as the DE gene F3 and PTGS2, which are implicated in immune responses and leukocyte recruitment [PMC7959717]. In the duodenum, bta-mir-2284d is inversely associated with MYC and NLK transcripts that are linked to lymphoid tissue structure and development [PMC7959717]. Despite its identification in multiple bovine miRNA studies, detailed functional information about bta-mir-2284d remains limited [PMC7959717]. The down-regulation of bta-mir-2284d in super-shedders (SS) suggests its potential role in modulating immune functions and lipid metabolism within the intestinal tract, which may affect E. coli O157 interactions [PMC7959717'>PMC7959717]. The miRNA is also associated with hematological system development and function as indicated by enriched negatively correlated target transcripts [PMC7959717]. Intriguingly, bta-mir-2284d is located within an intron of the SWAP70 gene [PMC7959717], and its down-regulation across multiple intestinal regions of SS cattle suggests a broader impact on host-pathogen dynamics that could influence super-shedding phenomena [PMC7959717].
a ac A C A ucaag ug guug cAAAA GUU GUU GGGUUUUUCu c || |||| ||||| ||| ||| |||||||||| ac caac guuuu caa caa cucaaaaggg u c cu c a g cauuc
| Accession | MIMAT0011836 |
| Description | Bos taurus bta-miR-2284d-5p mature miRNA |
| Sequence | 11 - AAAAAGUUCGUUAGGGUUUUUC - 32 |
| Evidence |
experimental
Illumina [1] |
|