miRBase entry: bta-mir-2320

Stem-loop bta-mir-2320


Accession
MI0011342
Description
Bos taurus bta-mir-2320 precursor miRNA mir-2320
Gene
family?
RF03738; mir-2320

Literature search
3 open access papers mention bta-mir-2320
(8 sentences)

Sequence

334 reads, 3 reads per million, 46 experiments
uguccccaUGGCACAGGGUCCAGCUGUCGGCcgugauacccgaugggUCGAUGAUGGUCCCUGUGUUUUggggcg
.(.(((((.(((((((((.(((..((((((((.............)))))))).))).))))))))).)))))).

Structure
u u     U         U   GC        gugau 
 g cccca GGCACAGGG CCA  UGUCGGCc     a
 | ||||| ||||||||| |||  ||||||||     c
 c ggggU UUGUGUCCC GGU  GUAGCUgg     c
g -     U         U   -A        guagc 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr16: 50680566-50680640 [+]

Database links

Mature bta-miR-2320-5p

Accession MIMAT0011844
Description Bos taurus bta-miR-2320-5p mature miRNA
Sequence 9 - UGGCACAGGGUCCAGCUGUCGGC - 31
Evidence experimental
Illumina [1]

Mature bta-miR-2320-3p

Accession MIMAT0011845
Description Bos taurus bta-miR-2320-3p mature miRNA
Sequence 48 - UCGAUGAUGGUCCCUGUGUUUU - 69
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 19633723
    Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
    Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ
    PLoS One (2009) 4:e6349