miRBase entry: bta-mir-2469

Stem-loop bta-mir-2469


Accession
MI0011529
Description
Bos taurus bta-mir-2469 precursor miRNA

Literature search
1 open access papers mention bta-mir-2469
(2 sentences)

Sequence

20 reads, 1 reads per million, 5 experiments
ggUUACUGUAGGGCCUGCGGCUUccgcccgugcucgcggaccaccgccaccgccuuaccaugaagcc
((((.(.(((((((..((((..(((((........)))))...))))....)))))))...).))))

Structure
    A --U       --CU    -CU     ccg 
ggUU C   GUAGGGC    GCGG   Uccgc   u
|||| |   |||||||    ||||   |||||    
ccga g   cauuccg    cgcc   aggcg   g
    a uac       ccac    acc     cuc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr8: 11455248-11455314 [-]

Database links

Mature bta-miR-2469

Accession MIMAT0012059
Description Bos taurus bta-miR-2469 mature miRNA
Sequence 3 - UUACUGUAGGGCCUGCGGCUU - 23
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 19633723
    Repertoire of bovine miRNA and miRNA-like small regulatory RNAs expressed upon viral infection
    Glazov EA, Kongsuwan K, Assavalapsakul W, Horwood PF, Mitter N, Mahony TJ
    PLoS One (2009) 4:e6349