Bta-mir-2484 is a microRNA that has been found to exhibit increased expression in the peripheral blood mononuclear cells (PBMCs) of buffaloes infected with Mycobacterium paratuberculosis [PMC7242893]. It is one of the top three up-regulated miRNAs in these infected buffaloes, along with bta-miR-592 and bta-miR-1247-5p [PMC5766512]. Interestingly, bta-mir-2484 has also been detected in mammary glands infected with Staphylococcus aureus, suggesting a potential association between these two infections [PMC6600136]. It is worth noting that bta-mir-2484 appears to be nearly species-specific and does not have homologs in humans or mice [PMC6600136]. In a study validating the results obtained from RNA sequencing, bta-mir-2484 was one of the six miRNAs selected for examination using RT-qPCR [PMC6600136]. Additionally, it has been found to regulate CYP7A1 along with two other miRNAs (bta-miR-27a-3p and bta-miR-194) and one long non-coding RNA in a grass-fed group [PMC7969984].
c -a ug -a aa uuau uga aaugua caggguuauuaua uua a |||| ||| |||||| ||||||||||||| ||| agua acu uUACGU GUUUCAGUAGUAU AGu a c ag UA CG gg
Accession | MIMAT0012077 |
Description | Bos taurus bta-miR-2484 mature miRNA |
Sequence | 42 - GAGCUAUGAUGACUUUGAUUGCAU - 65 |
Evidence |
experimental
Illumina [1] |
|