miRBase entry: ssc-mir-378-1

Stem-loop ssc-mir-378-1


Accession
MI0013088
Description
Sus scrofa ssc-mir-378-1 precursor miRNA

Literature search
20 open access papers mention ssc-mir-378-1
(99 sentences)

Sequence

77 reads, 42 reads per million, 11 experiments
ccacccagggcuccugacuccagguccuguguguugccuggaaauagcACUGGACUUGGAGUCAGAAGGCcugcguggag
((((.((((.((.((((((((((((((.((((..(........)..)))).)))))))))))))).)).)))).))))..

Structure
--    c    g  c              u    gu gcc 
  ccac cagg cu cugacuccaggucc gugu  u   u
  |||| |||| || |||||||||||||| ||||  |    
  ggug gucC GA GACUGAGGUUCAGG CAcg  a   g
ga    c    G  A              U    au aag 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 157640353-157640432 [+]

Database links

Mature ssc-miR-378

Accession MIMAT0013868
Description Sus scrofa ssc-miR-378 mature miRNA
Sequence 49 - ACUGGACUUGGAGUCAGAAGGC - 70
Evidence experimental
cloned [1], Illumina [2]

References

  1. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  4. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100