miRBase entry: ssc-mir-486-1

Stem-loop ssc-mir-486-1


Accession
MI0013103
Description
Sus scrofa ssc-mir-486-1 precursor miRNA

Literature search
12 open access papers mention ssc-mir-486-1
(25 sentences)

Sequence

566 reads, 181 reads per million, 12 experiments
gcuggggcuucagggccagcucggaccucugaccucccugacgggUCCUGUACUGAGCUGCCCCGAGgcccucacugugc
...((((((((.((((.(((((((((....(((((.......)))))..)).))))))))))).))))))))........

Structure
-----gcu        a    c       -  cucu     cc 
        ggggcuuc gggc agcucgg ac    gaccu  c
        |||||||| |||| ||||||| ||    |||||  u
        ucccgGAG CCCG UCGAGUC UG    CUggg  g
cgugucac        C    -       A  --UC     ca 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr17: 12191266-12191345 [-]

Database links

Mature ssc-miR-486

Accession MIMAT0013886
Description Sus scrofa ssc-miR-486 mature miRNA
Sequence 46 - UCCUGUACUGAGCUGCCCCGAG - 67
Evidence experimental
Illumina [1-2]

References

  1. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  4. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100