miRBase entry: ssc-mir-125a

Stem-loop ssc-mir-125a


Accession
MI0013115
Description
Sus scrofa ssc-mir-125a precursor miRNA

Literature search
14 open access papers mention ssc-mir-125a
(36 sentences)

Sequence

1883 reads, 458 reads per million, 14 experiments
ggccucugagUCCCUGAGACCCUUUAACCUGUGaggacauccagggucacaggugagguucuugggagccuggcguccgg
.(((...(..((((.((((.((((..((((((((((....))....)))))))))))).))))))))..).)))......

Structure
-----g   ucu ag    U    C    UA        ----  a 
      gcc   g  UCCC GAGA CCUU  ACCUGUGa    gg c
      |||   |  |||| |||| ||||  ||||||||    ||  
      cgg   c  aggg uucu ggag  uggacacu    cc a
ggccug   --u cg    -    u    --        ggga  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr6: 51858852-51858931 [+]
Clustered miRNAs
2 other miRNAs are < 10 kb from ssc-mir-125a
Name Accession Chromosome Start End Strand Confidence




Database links

Mature ssc-miR-125a

Accession MIMAT0013897
Description Sus scrofa ssc-miR-125a mature miRNA
Sequence 11 - UCCCUGAGACCCUUUAACCUGUG - 33
Evidence experimental
Illumina [1,3-4], cloned [2]

References

  1. PubMed ID: 19917043
    MicroRNA identity and abundance in porcine skeletal muscles determined by deep sequencing
    "Nielsen M, Hansen JH, Hedegaard J, Nielsen RO, Panitz F, Bendixen C, Thomsen B"
    "Anim Genet (2010) 41:159-168

  2. PubMed ID: 20180025
    Cloning and characterization of microRNAs from porcine skeletal muscle and adipose tissue
    "Cho IS, Kim J, Seo HY, Lim DH, Hong JS, Park YH, Park DC, Hong KC, Whang KY, Lee YS"
    "Mol Biol Rep (2010) 37:3567-3574

  3. PubMed ID: 21312241
    MicroRNA identity and abundance in developing swine adipose tissue as determined by Solexa sequencing
    "Li G, Li Y, Li X, Ning X, Li M, Yang G"
    "J Cell Biochem (2011) 112:1318-1328

  4. PubMed ID: 24499489
    Exploration of microRNAs in porcine milk exosomes
    Chen T, Xi QY, Ye RS, Cheng X, Qi QE, Wang SB, Shu G, Wang LN, Zhu XT, Jiang QY, Zhang YL
    BMC Genomics (2014) 15:100