miRBase entry: zma-MIR171m

Stem-loop zma-MIR171m


Accession
MI0013207
Description
Zea mays zma-MIR171m precursor miRNA

Literature search
19 open access papers mention zma-MIR171m
(50 sentences)

Sequence

395 reads, 452 reads per million, 9 experiments
gUAUUGGCGCGCCUCAAUCCGAaggcguggcugauagauuggcgcggcagccauguucuuGGAUUGAGCCGCGUCAAUAUCu
(((((((((((.((((((((((.((((((((((...(.....)....)))))))))).)))))))))).)))))))))))..

Structure
--           C          a          -aua a 
  gUAUUGGCGCG CUCAAUCCGA ggcguggcug    g u
  ||||||||||| |||||||||| ||||||||||    | u
  UAUAACUGCGC GAGUUAGGuu uuguaccgac    c g
uC           C          c          ggcg g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr5: 20785928-20786009 [-]

Database links

Mature zma-miR171m-5p

Accession MIMAT0015331
Description Zea mays zma-miR171m-5p mature miRNA
Sequence 2 - UAUUGGCGCGCCUCAAUCCGA - 22
Evidence experimental
Illumina [1]

Mature zma-miR171m-3p

Accession MIMAT0013996
Description Zea mays zma-miR171m-3p mature miRNA
Sequence 61 - GGAUUGAGCCGCGUCAAUAUC - 81
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 19936050
    A genome-wide characterization of microRNA genes in maize
    Zhang L, Chia JM, Kumari S, Stein JC, Liu Z, Narechania A, Maher CA, Guill K, McMullen MD, Ware D
    PLoS Genet (2009) 5:e1000716