miRBase entry: hsa-mir-3117

Stem-loop hsa-mir-3117


Accession
MI0014130
Symbol
HGNC: MIR3117
Description
Homo sapiens hsa-mir-3117 precursor miRNA mir-3117
Gene
family?
RF03591; mir-3117

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3117 is a microRNA that has been identified as a hub gene associated with patient prognosis [PMC9660063]. It is regulated by HNRNPC [PMC9660063]. The risk score for MIR3117, along with other hub genes, can be calculated using a specific formula [PMC9660063]. MIR3117 has also been found to have lower expression levels in rice, maize, and sorghum [PMC6358896]. In various types of cancer, including breast cancer, colon cancer, ovarian cancer, and liver cancer, MIR3117 has been identified as one of several miRNAs that post-transcriptionally regulate PHLPP2 [PMC8078721]. In Triticum subgenome A and in Ehrhartoideae and Pooideae subfamilies of plants, MIR3117 has shown conservation and rapid evolution [PMC6651130]. Additionally, in Triticum wheat species, MIR3117 is part of several miRNA families that target NB-LRR transcripts and trigger the production of phasiRNAs [PMC7057497]. In a study on B‐ALL risk factors, the SNPs rs12402181 in MIR3117 and rs62571442 in mir3689 were found to be associated with B‐ALL risk through their effect on the MAPK signaling pathway [PMC7167988]. Finally, in miRNA expression signatures related to various conditions or diseases including B‐ALL risk factors or prognosis prediction models for breast cancer patients or patients with acute myeloid leukemia (AML), MIR3117 was one of the top-ranked miRNAs identified [PMC9284388].

Literature search
1 open access papers mention hsa-mir-3117
(1 sentences)

Sequence

605 reads, 24 reads per million, 43 experiments
cccuaaagggccAGACACUAUACGAGUCAUAUaagggaaggcauuAUAGGACUCAUAUAGUGCCAGguguuuuguggg
((((((((.(((.(.(((((((.(((((.(((((.(.....).))))).))))).))))))).).))).))))).)))

Structure
   -     g   A A       C     A     g g 
ccc uaaag gcc G CACUAUA GAGUC UAUaa g a
||| ||||| ||| | ||||||| ||||| ||||| | a
ggg guuuu ugG C GUGAUAU CUCAG AUAuu c g
   u     g   A C       A     G     a g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 66628440-66628517 [+]

Disease association
hsa-mir-3117 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3117-3p

Accession MIMAT0014979
Description Homo sapiens hsa-miR-3117-3p mature miRNA
Sequence 46 - AUAGGACUCAUAUAGUGCCAG - 66
Evidence experimental
Illumina [1-3]
Database links
Predicted targets

Mature hsa-miR-3117-5p

Accession MIMAT0019197
Description Homo sapiens hsa-miR-3117-5p mature miRNA
Sequence 13 - AGACACUAUACGAGUCAUAU - 32
Evidence experimental
Illumina [2-3]

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86

  3. PubMed ID: 21606961
    Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia
    "Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML"
    "Leukemia (2011) 25:1389-1399