MIR3117 is a microRNA (miRNA) that has been identified as a hub gene with prognostic significance in certain cancers and is associated with patient prognosis [PMC9660063]. It is regulated by HNRNPC and contributes to a risk score model for patient outcomes [PMC9660063]. MIR3117 has been observed to have lower expression levels in certain cereal crops such as rice, maize, and sorghum [PMC6358896]. It plays a role in post-transcriptional regulation of PHLPP2 across various cancers, including breast, colon, ovarian, and liver cancer [PMC8078721]. The rapid expansion of MIR3117 in the Triticum subgenome A suggests its quick evolutionary changes over short timescales [PMC6651130]'>PMC6651130], and it is conserved within the Ehrhartoideae and Pooideae subfamilies [PMC6651130]. In Triticum species (wheat), MIR3117 targets NB-LRR transcripts to trigger the production of phased small interfering RNAs (phasiRNAs) [PMC7057497], which are involved in plant defense mechanisms. A significant association has been found between the MIR3117 rs7512692 C>T polymorphism and tumor grade in cancer patients [PMC8184203]. Additionally, single nucleotide polymorphisms (SNPs) within MIR3117 have been linked to an increased risk of B-cell acute lymphoblastic leukemia (B-ALL), potentially affecting the MAPK signaling pathway [PMC7167988], highlighting its role in disease susceptibility.
- g A A C A g g ccc uaaag gcc G CACUAUA GAGUC UAUaa g a ||| ||||| ||| | ||||||| ||||| ||||| | a ggg guuuu ugG C GUGAUAU CUCAG AUAuu c g u g A C A G a g
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0014979 | 
| Description | Homo sapiens hsa-miR-3117-3p mature miRNA | 
| Sequence | 46 - AUAGGACUCAUAUAGUGCCAG - 66 | 
| Evidence | 
                                    experimental
                                    
                                     Illumina [1-3]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                  
                                      
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                
                                        
                                     | 
                                
| Accession | MIMAT0019197 | 
| Description | Homo sapiens hsa-miR-3117-5p mature miRNA | 
| Sequence | 13 - AGACACUAUACGAGUCAUAU - 32 | 
| Evidence | 
                                    experimental
                                    
                                     Illumina [2-3]  | 
                            
                        
  |