miRBase entry: hsa-mir-3117

Stem-loop hsa-mir-3117


Accession
MI0014130
Symbol
HGNC: MIR3117
Description
Homo sapiens hsa-mir-3117 precursor miRNA mir-3117
Gene
family?
RF03591; mir-3117

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR3117 is a microRNA (miRNA) that has been identified as a hub gene with prognostic significance in certain cancers and is associated with patient prognosis [PMC9660063]. It is regulated by HNRNPC and contributes to a risk score model for patient outcomes [PMC9660063]. MIR3117 has been observed to have lower expression levels in certain cereal crops such as rice, maize, and sorghum [PMC6358896]. It plays a role in post-transcriptional regulation of PHLPP2 across various cancers, including breast, colon, ovarian, and liver cancer [PMC8078721]. The rapid expansion of MIR3117 in the Triticum subgenome A suggests its quick evolutionary changes over short timescales [PMC6651130]'>PMC6651130], and it is conserved within the Ehrhartoideae and Pooideae subfamilies [PMC6651130]. In Triticum species (wheat), MIR3117 targets NB-LRR transcripts to trigger the production of phased small interfering RNAs (phasiRNAs) [PMC7057497], which are involved in plant defense mechanisms. A significant association has been found between the MIR3117 rs7512692 C>T polymorphism and tumor grade in cancer patients [PMC8184203]. Additionally, single nucleotide polymorphisms (SNPs) within MIR3117 have been linked to an increased risk of B-cell acute lymphoblastic leukemia (B-ALL), potentially affecting the MAPK signaling pathway [PMC7167988], highlighting its role in disease susceptibility.

Literature search
1 open access papers mention hsa-mir-3117
(1 sentences)

Sequence

605 reads, 8 reads per million, 43 experiments
cccuaaagggccAGACACUAUACGAGUCAUAUaagggaaggcauuAUAGGACUCAUAUAGUGCCAGguguuuuguggg
((((((((.(((.(.(((((((.(((((.(((((.(.....).))))).))))).))))))).).))).))))).)))

Structure
   -     g   A A       C     A     g g 
ccc uaaag gcc G CACUAUA GAGUC UAUaa g a
||| ||||| ||| | ||||||| ||||| ||||| | a
ggg guuuu ugG C GUGAUAU CUCAG AUAuu c g
   u     g   A C       A     G     a g 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 66628440-66628517 [+]

Disease association
hsa-mir-3117 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3117-3p

Accession MIMAT0014979
Description Homo sapiens hsa-miR-3117-3p mature miRNA
Sequence 46 - AUAGGACUCAUAUAGUGCCAG - 66
Evidence experimental
Illumina [1-3]
Database links
Predicted targets

Mature hsa-miR-3117-5p

Accession MIMAT0019197
Description Homo sapiens hsa-miR-3117-5p mature miRNA
Sequence 13 - AGACACUAUACGAGUCAUAU - 32
Evidence experimental
Illumina [2-3]

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86

  3. PubMed ID: 21606961
    Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia
    "Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML"
    "Leukemia (2011) 25:1389-1399