MIR3134 is a wheat- and barley-specific microRNA (miRNA) that does not have a conserved presence across monocot and dicot plants, distinguishing it from miRNAs like miR159 [PMC4425524]. The study in question did not utilize barley stripe mosaic virus (BSMV) vectors but rather a cucumber mosaic virus (CWMV) VIGS vector to investigate the role of MIR3134 and its potential to modulate miRNA levels in wheat [PMC4425524]. It was found that the mRNA levels of MIR3134's candidate target gene increased in wheat infected with a modified CWMV vector, suggesting that this virus vector can influence gene expression [PMC6247046]. Contrary to the original summary, stem-loop RT-qPCR assays showed that mature MIR3134 levels decreased in wheat plants infected with CWMV vectors designed to suppress this specific miRNA [PMC6247046]. The study's approach indeed involved cloning MIR3134 into a vector using the short tandem target mimic (STTM) strategy to suppress its expression and investigate the effects on wheat [PMC6247046].
c c gga
uguauccaauguguagucuuuuaucc uca au g
|||||||||||||||||||||||||| ||| ||
acaugggUUAUACAUCAGAAAAUAGG AGU ua u
U a aaa
| Accession | MIMAT0015000 |
| Description | Homo sapiens hsa-miR-3134 mature miRNA |
| Sequence | 45 - UGAUGGAUAAAAGACUACAUAUU - 67 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|