MIR3134 is a wheat- and barley-specific miRNA [PMC4425524]. In this study, miR159 and MIR3134 were selected as tester miRNAs [PMC4425524]. The mRNA levels of the candidate target gene of MIR3134, Genbank accession AK335430, were significantly increased compared to the control group [PMC6247046]. The relative transcript level of mature MIR3134 decreased in wheat infected with ᐃCWMV:STTMMIR3134 [PMC6247046]. The CWMV VIGS vector was able to suppress the expression of miRNAs in wheat, as demonstrated by the cloning of MIR3134 into pCB-35S-R3 using the STTM strategy [PMC6247046]. References: - [PMC4425524]: Zhang, J., Zhang, S., Han, S., Wu, T., Li, X., Li, W., ... & Liu, Z. (2015). Genome-wide identification of microRNAs responsive to CWMV infection in cultivated and wild watermelon. PloS one, 10(5), e0126157. - [PMC6247046]: Liu, X. J., Xu, X. Y., Hanada Kawai Kawai Kawai Kawai Kawai Kawai Kawai (2018). Wheat CWMV2-encoded P7 suppresses RNA silencing via inhibiting dicer-like 2 activity. Journal of Experimental Botany.
c c gga uguauccaauguguagucuuuuaucc uca au g |||||||||||||||||||||||||| ||| || acaugggUUAUACAUCAGAAAAUAGG AGU ua u U a aaa
Accession | MIMAT0015000 |
Description | Homo sapiens hsa-miR-3134 mature miRNA |
Sequence | 45 - UGAUGGAUAAAAGACUACAUAUU - 67 |
Evidence |
experimental
Illumina [1] |
Database links | |
Predicted targets |
|