miRBase entry: hsa-mir-466

Stem-loop hsa-mir-466


Accession
MI0014157
Symbol
HGNC: MIR466
Description
Homo sapiens hsa-mir-466 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR466 is a microRNA (miRNA) implicated in the regulation of gene expression in various biological processes, including the stress response in sorghum, where it is known to regulate serine/threonine protein kinase [PMC5360763]. In the context of age-related macular degeneration (AMD), MIR466, along with mir1186, targets five genes that show differential expression in patients: Lcp1, Nox4, Rgs5, Dst, and Cpm [PMC5429617]. Additionally, MIR466 is one of several miRNAs that have been identified to bind to the 3′ UTR region of MMP9 and potentially downregulate its expression [PMC4568920]. In cardiovascular disease models specifically related to diabetes, MIR466 has been shown to regulate matrix metalloproteinase-9 (MMP-9) and promote endothelial cell proliferation and capillary-like structure formation [PMC8355361]. Furthermore, for experimental modulation of miRNA activity in endothelial cells (ECs), a specific inhibitor for MIR466 has been developed and utilized [PMC9307898].

Literature search
18 open access papers mention hsa-mir-466
(46 sentences)

Sequence

53 reads, 2 reads per million, 21 experiments
guguguguauauguguguugcauguguguauauguguguauauauguacacAUACACAUACACGCAACACACAUauauacaugc
(((((((((((((((((((((.(((((((.((((((((........)))))))).))))))).)))))))))))))))))))))

Structure
                     a       a        uau 
guguguguauauguguguugc ugugugu uaugugug   a
||||||||||||||||||||| ||||||| ||||||||    
cguacauauaUACACACAACG ACAUACA AUAcacau   u
                     C       C        gua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr3: 31161704-31161787 [-]

Disease association
hsa-mir-466 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-466

Accession MIMAT0015002
Description Homo sapiens hsa-miR-466 mature miRNA
Sequence 52 - AUACACAUACACGCAACACACAU - 74
Evidence experimental
Illumina [1-2]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86