miRBase entry: hsa-mir-3154

Stem-loop hsa-mir-3154


Accession
MI0014182
Symbol
HGNC: MIR3154
Description
Homo sapiens hsa-mir-3154 precursor miRNA mir-3154
Gene
family?
RF03301; mir-3154

Literature search
1 open access papers mention hsa-mir-3154
(1 sentences)

Sequence

155 reads, 56 reads per million, 32 experiments
ggccccuccuucucagccccagcucccgcucaccccugccacgucaaaggaggCAGAAGGGGAGUUGGGAGCAGAgaggggacc
((((((((..(((..((((((((((((.((.....(((((.(......)..))))).)))))))))))).))))))))))).))

Structure
  -      cu   ca  -          g  caccc     -a gu 
gg ccccuc  ucu  gc cccagcuccc cu     cugcc  c  c
|| ||||||  |||  || |||||||||| ||     |||||  |   
cc ggggag  AGA  CG GGGUUGAGGG GA     GACgg  g  a
  a      --   --  A          -  ----A     ag aa 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Berezikov et al. proposed this sequence as a miRNA candidate based on the RAKE method [1]. Goff et al. [2] and Stark et al. [3] later validated its expression in human using high-throughput sequencing.

Genome context
chr9: 128244947-128245030 [-]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-3154
Name Accession Chromosome Start End Strand Confidence




Database links

Mature hsa-miR-3154

Accession MIMAT0015028
Description Homo sapiens hsa-miR-3154 mature miRNA
Sequence 54 - CAGAAGGGGAGUUGGGAGCAGA - 75
Evidence experimental
SOLiD [2], Illumina [3-5]
Database links
Predicted targets

References

  1. PubMed ID: 16954537
    Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis
    "Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E"
    "Genome Res (2006) 16:1289-1298

  2. PubMed ID: 19784364
    Ago2 immunoprecipitation identifies predicted microRNAs in human embryonic stem cells and neural precursors
    Goff LA, Davila J, Swerdel MR, Moore JC, Cohen RI, Wu H, Sun YE, Hart RP
    PLoS One (2009) 4:e7192

  3. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  4. PubMed ID: 21606961
    Discovery of new microRNAs by small RNAome deep sequencing in childhood acute lymphoblastic leukemia
    "Schotte D, Akbari Moqadam F, Lange-Turenhout EA, Chen C, van Ijcken WF, Pieters R, den Boer ML"
    "Leukemia (2011) 25:1389-1399

  5. PubMed ID: 22454130
    Transcription factors are targeted by differentially expressed miRNAs in primates
    "Dannemann M, Prufer K, Lizano E, Nickel B, Burbano HA, Kelso J"
    "Genome Biol Evol (2012) 4:552-564