Stem-loop hsa-mir-3180-2

Accession

MI0014215

Symbol

HGNC: MIR3180-2

Description

Homo sapiens hsa-mir-3180-2 precursor miRNA mir-3180

Gene
family

RF02010; mir-3180

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR3180-2 is a long non-coding RNA (lncRNA) that has been identified as highly co-expressed with Alzheimer's disease (AD)-related genes, suggesting a potential role in the disease's pathology [PMC7047416]. This lncRNA, along with MIR3180-3, is involved in targeting protein-coding genes (PCGs) associated with neuroprotective roles and blood vessel remodeling, which are critical processes in the context of AD [PMC7047416]. MIR3180-2 shares a significant number of co-expressed PCGs with MIR3180-3, including AD-related genes such as VTI1A and S100B [PMC7047416]. Furthermore, MIR3180-2 has been highlighted as a differentially expressed lncRNA in cerebral tissue and is considered a potential marker for AD alongside other lncRNAs like RP3-522J7 [PMC7047416]. Notably, it was found to be one of the top downregulated lncRNAs in an analysis focused on gene expression changes associated with AD [PMC7388310]. Co-expression network analysis underscores the importance of MIR3180-2 by showing its frequent co-expression with genes that increase the risk for AD [PMC8774680], indicating its potential utility in further research and therapeutic targeting for Alzheimer's disease.

Literature search

6 open access papers mention hsa-mir-3180-2
(60 sentences)

Sequence

4453 reads, 123 reads per million, 63 experiments

gcgacgggcggagCUUCCAGACGCUCCGCCCCACGUCGcaugcgccccgggaaagcgUGGGGCGGAGCUUCCGGAGGCCccgcccugc
(((..((((((.((((((.((.((((((((((((((....(.((...)).)...)))))))))))))).)).)))))).)))))))))

Structure

   ac      a      A  C              CGca g  c 
gcg  gggcgg gCUUCC GA GCUCCGCCCCACGU    u cg  
|||  |||||| |||||| || ||||||||||||||    | || c
cgu  cccgcc CGGAGG CU CGAGGCGGGGUgcg    g gc  
   --      C      C  U              -aaa g  c 

Annotation confidence High

Genome context

chr16: 16309879-16309966 [+]

Clustered miRNAs

2 other miRNAs are < 10 kb from hsa-mir-3180-2

Disease association

hsa-mir-3180-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-3180-5p

• Accession: MIMAT0015057
• Description: Homo sapiens hsa-miR-3180-5p mature miRNA
• Sequence: 14 - CUUCCAGACGCUCCGCCCCACGUCG - 38
• Evidence: experimental ; Illumina [1]

Mature hsa-miR-3180-3p

• Accession: MIMAT0015058
• Description: Homo sapiens hsa-miR-3180-3p mature miRNA
• Sequence: 58 - UGGGGCGGAGCUUCCGGAGGCC - 79
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20300190
   Characterization of the Melanoma miRNAome by Deep Sequencing
   "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
   "PLoS One (2010) 5:e9685


2. PubMed ID: 21199797
   Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
   "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
   "Cancer Res (2011) 71:78-86