MIR3180-3, a microRNA, has been identified as having a disruptive presence in an individual from Tibet, affecting its target genes CD44 and FAM115A [PMC3938728]. This microRNA is also implicated in Alzheimer's disease (AD), as it targets genes involved in neuroprotective roles and blood vessel remodeling [PMC7047416]. MIR3180-3 is differentially expressed alongside other lncRNAs and PCGs that are potential markers for AD, sharing co-expressed PCGs such as VTI1A and CUX1 that are associated with AD [PMC7047416]. It is highly expressed in cerebral tissue, indicating its significance in brain-related functions and diseases [PMC7047416]. Furthermore, MIR3180-3 has been found to be co-expressed with well-known AD-related genes within a network analysis [PMC7047416]. In the context of breast cancer, MIR3180-3 is identified in multiple breast cancer cell lines but absent in normal-like cell lines, suggesting its potential role as an oncogenic factor [PMC8261273]. However, it is not accurate to state that it regulates several target genes within the luminal-A subtype of breast cancer cells; the evidence only specifies that it targets the gene A4GALT in luminal-A breast cancer cells [PMC8261273], indicating its involvement in this particular disease and cellular process.
                            cagu   ac      a      A  C              CGca g  c 
    gcg  gggcgg gCUUCC GA GCUCCGCCCCACGU    u cg  
    |||  |||||| |||||| || ||||||||||||||    | || c
    cgu  cccgcc CGGAGG CU CGAGGCGGGGUgcg    g gc  
--gu   --      C      C  U              -aaa g  c 
            | Name | Accession | Chromosome | Start | End | Strand | Confidence | 
|---|
| Disease | Description | Category | PubMed ID | 
|---|
| Accession | MIMAT0015057 | 
| Description | Homo sapiens hsa-miR-3180-5p mature miRNA | 
| Sequence | 18 - CUUCCAGACGCUCCGCCCCACGUCG - 42 | 
| Evidence | 
                                    experimental
                                    
                                     Illumina [1]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                 
                                       
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                
                                        
                                     | 
                                
| Accession | MIMAT0015058 | 
| Description | Homo sapiens hsa-miR-3180-3p mature miRNA | 
| Sequence | 62 - UGGGGCGGAGCUUCCGGAGGCC - 83 | 
| Evidence | 
                                    experimental
                                    
                                     Illumina [1]  | 
                            
| Database links | 
                                    
                                                
                                                     
                                  
                                      
                                        
                                           
                                          
                                           
                                        
                                           
                                          
                                           
                                       
                                   
                                 | 
| Predicted targets | 
                                        
                                          
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                            
                                                
                                                     
                                                
                                            
                                            
                                           
                                          
                                         
                                        
                                
                                        
                                
                                        
                                
                                        
                                     | 
                                
                        
  |