miRBase entry: hsa-mir-3065

Stem-loop hsa-mir-3065


Accession
MI0014228
Symbol
HGNC: MIR3065
Description
Homo sapiens hsa-mir-3065 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR3065 is a nonprotein coding regulatory gene implicated in breast cancer (BC) development, particularly among African American women, as suggested by a study by Perrson et al. [PMC5989404]. This microRNA is transcribed in the opposite direction from its host gene, apoptosis-associated tyrosine kinase (AATK), within the seventh intron of BAIAP2 [PMC5989404]. It has been identified in regions of genomic amplification across various BC subtypes and exhibits a notably different expression pattern between normal and breast tumor tissues [PMC5989404]. The expression of MIR3065 is highest in breast tumors compared to other tissues, with lung and placenta showing the next highest levels [PMC5989404'>PMC5989404'>PMC5989404]. Single nucleotide polymorphisms (SNPs) within the BAIAP2 intron and pri-MIR3065 sequence may affect MIR3065 biogenesis and BAIAP2 expression, potentially influencing BC risk [PMC5989404]. Functional studies are needed to elucidate the molecular mechanisms behind MIR3065's association with BC risk, especially estrogen receptor-positive BC [PMC5989404]. Moreover, MIR3065 may play a role in suppressing oncogenes as it targets genes like ARID4B and RAB22A involved in cancer development [PMC5989404].

Literature search
24 open access papers mention hsa-mir-3065
(106 sentences)

Sequence

19063 reads, 59.0 reads per million, 160 experiments
cugcccucuUCAACAAAAUCACUGAUGCUGGAgucgccugagucaucacUCAGCACCAGGAUAUUGUUGGAGaggacag
(((.((((((((((((.(((.(((.(((((((.((....)).))......))))).)))))).)))))))))))).)))

Structure
   c            A   A   A     ------  g  g 
cug ccucuUCAACAA AUC CUG UGCUG      GA uc c
||| |||||||||||| ||| ||| |||||      || ||  
gac ggaGAGGUUGUU UAG GAC ACGAC      cu ag c
   a            A   -   C     Ucacua  g  u 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr17: 81125877-81125955 [+]
Clustered miRNAs
3 other miRNAs are < 10 kb from hsa-mir-3065
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-3065 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3065-5p

Accession MIMAT0015066
Description Homo sapiens hsa-miR-3065-5p mature miRNA
Sequence 10 - UCAACAAAAUCACUGAUGCUGGA - 32
Evidence experimental
Illumina [1,3], 454 [2]
Database links
Predicted targets

Mature hsa-miR-3065-3p

Accession MIMAT0015378
Description Homo sapiens hsa-miR-3065-3p mature miRNA
Sequence 50 - UCAGCACCAGGAUAUUGUUGGAG - 72
Evidence experimental
Illumina [1,3], 454 [2]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685

  2. PubMed ID: 20483914
    Discovery of microRNAs and other small RNAs in solid tumors
    "Meiri E, Levy A, Benjamin H, Ben-David M, Cohen L, Dov A, Dromi N, Elyakim E, Yerushalmi N, Zion O, Lithwick-Yanai G, Sitbon E"
    "Nucleic Acids Res (2010) 38:6234-6246

  3. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86