MIR3065 is an important nonprotein coding regulatory gene that may play a key role in breast cancer (BC) development and heterogeneity among African American (AA) women [PMC5989404]. It is located in the seventh intron of the apoptosis-associated tyrosine kinase (AATK) gene and transcribed in the opposite direction from its host gene [PMC5989404]. MIR3065 has been found to be encoded in a region with high-level genomic amplification in various subtypes of BC [PMC5989404]. It has been shown to have a disparate expression pattern between normal breast tissue and breast tumors [PMC5989404'>PMC5989404'>PMC5989404'>PMC5989404'>PMC5989404]. The genomic region that includes MIR3065 also contains the brain-specific angiogenesis inhibitor 1-associated protein 2 (BAIAP2) gene [PMC5989404]. The role of MIR3065 may be to suppress expression of oncogenes, as it has been found to have predicted targets that are likely oncogenes [PMC5989404]. Functional assessment is needed to understand the molecular mechanism behind the association between BC risk, particularly ER positive BC, and SNPs in BAIAP2 and MIR3065 [PMC5989404]. MIR3065 shares its genomic location with mature MIR338, but they are transcribed from opposite DNA strands [PMC5989404]. Additionally, a SNP within the precursor sequence of MIR4739 has been found near one of the top hits in MIR3065 but is not highly linked with it [PMC5989404]. Among TargetScan's predicted gene targets for MIR3065 are AT-rich interaction domain 4B (ARID4B) and RAB22A, which are involved in signal transduction and belong to oncogene families [PMC5989404][PMID:10138222[PMID:10138222].
c A A A ------ g g cug ccucuUCAACAA AUC CUG UGCUG GA uc c ||| |||||||||||| ||| ||| ||||| || || gac ggaGAGGUUGUU UAG GAC ACGAC cu ag c a A - C Ucacua g u
Name | Accession | Chromosome | Start | End | Strand | Confidence |
---|
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0015066 |
Description | Homo sapiens hsa-miR-3065-5p mature miRNA |
Sequence | 10 - UCAACAAAAUCACUGAUGCUGGA - 32 |
Evidence |
experimental
Illumina [1,3], 454 [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
Accession | MIMAT0015378 |
Description | Homo sapiens hsa-miR-3065-3p mature miRNA |
Sequence | 50 - UCAGCACCAGGAUAUUGUUGGAG - 72 |
Evidence |
experimental
Illumina [1,3], 454 [2] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|