MIR3188 is a microRNA implicated in various biological pathways and diseases, including its role in regulating the mTOR and PI3K/AKT pathways, which are crucial for insulin signaling in endothelial cells [PMC8673831]. Its expression is influenced by the presence of the rs7247237 polymorphism, which has been associated with type 2 diabetes mellitus (T2DM) [PMC8673831]. In nasopharyngeal carcinoma (NPC), a type of cancer with multiple etiological factors including Epstein–Barr virus (EBV) exposure, diet, and genetic factors, MIR3188 has been identified as one of the miRNAs associated with a good prognosis [PMC6368411]. Furthermore, MIR3188 has been suggested as a potential therapeutic target for non-small cell lung cancer (NSCLC) treatment [PMC6297856]. Systems biology tools like miRUPnet have highlighted the functional importance of MIR3188 by showing that its target genes are critical in various cancer pathways and that it is significantly associated with chromatin binding [PMC4371809]. Additionally, MIR3188 expression levels were found to be upregulated in iAs-T cells but downregulated upon reversal in iAs-Rev cells [PMC4371809]. The accurate identification and quantification of MIR3188 are crucial for fundamental research into NPC pathogenesis and prognosis due to its role in cell-cycle transition reduction, proliferation inhibition, survival time prolongation of tumor-bearing mice, and sensitization to 5-FU treatment [PMC8695942].
ggc u c g - c u cgc gccucc gcucug ugu ccgc cagggccuc cc ag g |||||| |||||| ||| |||| ||||||||| || || cggagg cGGGGC AUA GGCG GUUUCGGAG gg uc c -uc u - - U A - uuc
Accession | MIMAT0015070 |
Description | Homo sapiens hsa-miR-3188 mature miRNA |
Sequence | 53 - AGAGGCUUUGUGCGGAUACGGGG - 75 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|