miRBase entry: hsa-mir-3188

Stem-loop hsa-mir-3188


Accession
MI0014232
Symbol
HGNC: MIR3188
Description
Homo sapiens hsa-mir-3188 precursor miRNA mir-3188
Gene
family?
RF03451; mir-3188

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR3188 is a microRNA implicated in various biological pathways and diseases, including its role in regulating the mTOR and PI3K/AKT pathways, which are crucial for insulin signaling in endothelial cells [PMC8673831]. Its expression is influenced by the presence of the rs7247237 polymorphism, which has been associated with type 2 diabetes mellitus (T2DM) [PMC8673831]. In nasopharyngeal carcinoma (NPC), a type of cancer with multiple etiological factors including Epstein–Barr virus (EBV) exposure, diet, and genetic factors, MIR3188 has been identified as one of the miRNAs associated with a good prognosis [PMC6368411]. Furthermore, MIR3188 has been suggested as a potential therapeutic target for non-small cell lung cancer (NSCLC) treatment [PMC6297856]. Systems biology tools like miRUPnet have highlighted the functional importance of MIR3188 by showing that its target genes are critical in various cancer pathways and that it is significantly associated with chromatin binding [PMC4371809]. Additionally, MIR3188 expression levels were found to be upregulated in iAs-T cells but downregulated upon reversal in iAs-Rev cells [PMC4371809]. The accurate identification and quantification of MIR3188 are crucial for fundamental research into NPC pathogenesis and prognosis due to its role in cell-cycle transition reduction, proliferation inhibition, survival time prolongation of tumor-bearing mice, and sensitization to 5-FU treatment [PMC8695942].

Literature search
2 open access papers mention hsa-mir-3188
(3 sentences)

Sequence

274 reads, 3 reads per million, 48 experiments
ggcgccuccugcucugcugugccgccagggccuccccuagcgcgccuucuggAGAGGCUUUGUGCGGAUACGGGGcuggaggccu
...((((((.((((((.(((.(((((((((((((.((.((........)))).))))))))).))))))))))))).))))))..

Structure
ggc      u      c   g    -         c  u  cgc 
   gccucc gcucug ugu ccgc cagggccuc cc ag   g
   |||||| |||||| ||| |||| ||||||||| || ||    
   cggagg cGGGGC AUA GGCG GUUUCGGAG gg uc   c
-uc      u      -   -    U         A  -  uuc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr19: 18282077-18282161 [+]

Database links

Mature hsa-miR-3188

Accession MIMAT0015070
Description Homo sapiens hsa-miR-3188 mature miRNA
Sequence 53 - AGAGGCUUUGUGCGGAUACGGGG - 75
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20300190
    Characterization of the Melanoma miRNAome by Deep Sequencing
    "Stark MS, Tyagi S, Nancarrow DJ, Boyle GM, Cook AL, Whiteman DC, Parsons PG, Schmidt C, Sturm RA, Hayward NK"
    "PLoS One (2010) 5:e9685