WARNING: This summary was generated by AI. Bta-mir-3432a is a microRNA (miRNA) identified in bovine species that has been subjected to validation studies to confirm its abundance in cellular fractions [PMC9783024]. This miRNA was among those selected for validation through quantitative PCR (qPCR) to verify the accuracy of high-throughput sequencing results, specifically in the context of its differential abundance in X and Y bovine sperm [PMC7505075]. Bta-mir-3432a is noted for being upregulated in Y sperm and is implicated in targeting genes related to catabolic processes, which are essential for oocyte maturation and embryogenesis [PMC7505075]. It has been identified as one of the miRNAs that are more enriched in Y sperm, indicating a potential role in sex-specific regulatory processes [PMC7505075]. Additionally, bta-mir-3432a is believed to target the maternal gene thyroid hormone receptor interactor 12 (Trip12), which plays a significant role during embryonic development [PMC7505075]. However, the involvement of bta-mir-3432a with 17 target genes related to catabolic processes within mature oocytes is not exclusive, as it is shared with other differentially abundant miRNAs, suggesting a broader functional significance within reproductive biology [PMC7505075].
-c - ugU G --U ----- U g uucgaucuuug ucaugg GC GGAUCUU AGUUGU GG Gu c ||||||||||| |||||| || ||||||| |||||| || || agguuaggaac aguacc ug ccuaggg ucgacg uc ca a cc c --u a ugu uugac u a
| Accession | MIMAT0017396 |
| Description | Bos taurus bta-miR-3432a mature miRNA |
| Sequence | 21 - UGCGGGAUCUUUAGUUGUGGUG - 42 |
| Evidence |
experimental
qPCR [2], Illumina [3] |
|