miRBase entry: bta-mir-3432a-1

Stem-loop bta-mir-3432a-1


Accession
MI0014500
Description
Bos taurus bta-mir-3432a-1 precursor miRNA mir-3432
Gene
family?
RF03767; mir-3432

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. Bta-mir-3432a is a microRNA (miRNA) identified in bovine species that has been subjected to validation studies to confirm its abundance in cellular fractions [PMC9783024]. This miRNA was among those selected for validation through quantitative PCR (qPCR) to verify the accuracy of high-throughput sequencing results, specifically in the context of its differential abundance in X and Y bovine sperm [PMC7505075]. Bta-mir-3432a is noted for being upregulated in Y sperm and is implicated in targeting genes related to catabolic processes, which are essential for oocyte maturation and embryogenesis [PMC7505075]. It has been identified as one of the miRNAs that are more enriched in Y sperm, indicating a potential role in sex-specific regulatory processes [PMC7505075]. Additionally, bta-mir-3432a is believed to target the maternal gene thyroid hormone receptor interactor 12 (Trip12), which plays a significant role during embryonic development [PMC7505075]. However, the involvement of bta-mir-3432a with 17 target genes related to catabolic processes within mature oocytes is not exclusive, as it is shared with other differentially abundant miRNAs, suggesting a broader functional significance within reproductive biology [PMC7505075].

Literature search
3 open access papers mention bta-mir-3432a-1
(4 sentences)

Sequence

3799 reads, 19 reads per million, 66 experiments
cuucgaucuuugucauggugUGCGGGAUCUUUAGUUGUGGUGugcaaacucucaguugcagcuugugggauccaguuccaugaccaaggauuggacc
.(((((((((((((((((...((.(((((((.((((((((.((....)).)).....))))))...))))))).)).)))))).)))))))))))..

Structure
-c           -      ugU  G       --U      -----  U  g 
  uucgaucuuug ucaugg   GC GGAUCUU   AGUUGU     GG Gu c
  ||||||||||| ||||||   || |||||||   ||||||     || ||  
  agguuaggaac aguacc   ug ccuaggg   ucgacg     uc ca a
cc           c      --u  a       ugu      uugac  u  a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
Jin et al. predicted this miRNA bioinformatically in [1], and validated its expression by qPCR in [2].

Genome context
chr21: 55992009-55992105 [-]

Database links

Mature bta-miR-3432a

Accession MIMAT0017396
Description Bos taurus bta-miR-3432a mature miRNA
Sequence 21 - UGCGGGAUCUUUAGUUGUGGUG - 42
Evidence experimental
qPCR [2], Illumina [3]

References

  1. PubMed ID: 19758457
    Characterization of bovine miRNAs by sequencing and bioinformatics analysis
    Jin W, Grant JR, Stothard P, Moore SS, Guan LL
    BMC Mol Biol (2009) 10:90

  2. PubMed ID: 20423511
    Characterization of microRNA expression in bovine adipose tissues: a potential regulatory mechanism of subcutaneous adipose tissue development
    Jin W, Dodson MV, Moore SS, Basarab JA, Guan LL
    BMC Mol Biol (2010) 11:29