miRBase entry: hsa-mir-1244-3

Stem-loop hsa-mir-1244-3


Accession
MI0015975
Symbol
HGNC: MIR1244-3
Description
Homo sapiens hsa-mir-1244-3 precursor miRNA mir-1244
Gene
family?
RF04271; mir-1244

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR1244-1 is a microRNA (miRNA) that is less than 22 nucleotides in length and has been identified as a downregulated tumor suppressor in a cluster that includes six other tumor suppressors [PMC8465636]. This miRNA has been consistently observed across different tissue types, indicating its disease-specific differential expression [PMC8323253]. Furthermore, MIR1244-1 is among the miRNAs that undergo hypermethylation due to tobacco exposure in the foetal cord blood of low-birth-weight newborns of smoking mothers, which may influence foetoplacental angiogenic and growth factors [PMC9571148]. The hypermethylation of MIR1244-1 and other miRNAs has been associated with the disruption of protein expression and key factors necessary for proper placental development [PMC9571148]. Additionally, MIR1244-1 was one of seven hypermethylated miRNAs identified in a genetic study focusing on cord blood from low-birth-weight newborns with smoking mothers [PMC9571148]. In terms of its prognostic value, MIR1244-1 has been recognized as an independent prognostic factor for certain diseases through multivariate Cox regression analysis [PMC9691390].

Literature search
7 open access papers mention hsa-mir-1244-3
(17 sentences)

Sequence

61 reads, 16 reads per million, 30 experiments
aucuuauuccgagcauuccaguaacuuuuuuguguauguacuuagcuguacuauAAGUAGUUGGUUUGUAUGAGAUGGUUaaaaa
(((((((.....(((..((((..(((......((((.((((......)))))))))))..))))..)))))))))).........

Structure
---------       uccga   uu    ua   uuuuug    u    uu 
         aucuuau     gca  ccag  acu      ugua guac  a
         |||||||     |||  ||||  |||      |||| ||||   
         UAGAGUA     UGU  GGUU  UGA      Auau caug  g
aaaaaUUGG       -----   UU    GA   ------    -    uc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr12: 9239467-9239551 [-]

Database links

Mature hsa-miR-1244

Accession MIMAT0005896
Description Homo sapiens hsa-miR-1244 mature miRNA
Sequence 55 - AAGUAGUUGGUUUGUAUGAGAUGGUU - 80
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 18285502
    Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells
    "Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA"
    "Genome Res (2008) 18:610-621