miRBase entry: hsa-mir-3916

Stem-loop hsa-mir-3916


Accession
MI0016422
Symbol
HGNC: MIR3916
Description
Homo sapiens hsa-mir-3916 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR3916 is a microRNA that has been identified as positively correlated with certain genes in the context of diabetic kidney disease (DKD), although specific reports on its role in DKD are lacking [PMC8325821]. It is differentially expressed in patients with mismatch repair (MMR) deficiency, with higher expression levels observed in MMR+ patients [PMC6036478]. MIR3916 has been implicated in the destabilization of desmosomes, which are cellular structures involved in cell adhesion, suggesting a potential role in aging-related cellular processes [PMC8282276]. Furthermore, MIR3916 is associated with the regulation of calcium handling genes, which are crucial for cardiac function and have been reported to be impaired with aging [PMC8282276]. Notably, MIR3916 appears to have a significant regulatory impact on cardiac genes, potentially influencing 63% of these genes across various functional categories [PMC8282276]. It also targets several cardiac-specific proteins such as TNNC1 and TNNT2, indicating its involvement in the regulation of heart muscle proteins [PMC8282276].

Literature search
1 open access papers mention hsa-mir-3916
(1 sentences)

Sequence

314 reads, 346 reads per million, 43 experiments
aucccagagaagaaggaagAAGAGGAAGAAAUGGCUGGUUCUCAGgugaaugugucuggguucaggggaugugucuccucuuuucuucugggau
((((((((......((((((.(((((.((.....((((..((((((........)))))).))))........)))))))))))))))))))))

Structure
        gaagaa      A     A  ---AAUGG    UU      uga 
aucccaga      ggaagA GAGGA GA        CUGG  CUCAGg   a
||||||||      |||||| ||||| ||        ||||  ||||||    
uagggucu      ucuuuu cuccu cu        gacu  gggucu   u
        ------      -     -  guguaggg    -u      gug 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr1: 247201967-247202060 [-]

Disease association
hsa-mir-3916 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-3916

Accession MIMAT0018190
Description Homo sapiens hsa-miR-3916 mature miRNA
Sequence 20 - AAGAGGAAGAAAUGGCUGGUUCUCAG - 45
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20224791
    Discovery of novel microRNAs in female reproductive tract using next generation sequencing
    Creighton CJ, Benham AL, Zhu H, Khan MF, Reid JG, Nagaraja AK, Fountain MD, Dziadek O, Han D, Ma L, Kim J, Hawkins SM, Anderson ML, Matzuk MM, Gunaratne PH
    PLoS One (2010) 5:e9637