WARNING: This summary was generated by AI. MIR3916 is a microRNA that has been identified as positively correlated with certain genes in the context of diabetic kidney disease (DKD), although specific reports on its role in DKD are lacking [PMC8325821]. It is differentially expressed in patients with mismatch repair (MMR) deficiency, with higher expression levels observed in MMR+ patients [PMC6036478]. MIR3916 has been implicated in the destabilization of desmosomes, which are cellular structures involved in cell adhesion, suggesting a potential role in aging-related cellular processes [PMC8282276]. Furthermore, MIR3916 is associated with the regulation of calcium handling genes, which are crucial for cardiac function and have been reported to be impaired with aging [PMC8282276]. Notably, MIR3916 appears to have a significant regulatory impact on cardiac genes, potentially influencing 63% of these genes across various functional categories [PMC8282276]. It also targets several cardiac-specific proteins such as TNNC1 and TNNT2, indicating its involvement in the regulation of heart muscle proteins [PMC8282276].
gaagaa A A ---AAUGG UU uga
aucccaga ggaagA GAGGA GA CUGG CUCAGg a
|||||||| |||||| ||||| || |||| ||||||
uagggucu ucuuuu cuccu cu gacu gggucu u
------ - - guguaggg -u gug
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0018190 |
| Description | Homo sapiens hsa-miR-3916 mature miRNA |
| Sequence | 20 - AAGAGGAAGAAAUGGCUGGUUCUCAG - 45 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|