miRBase entry: gma-MIR1520g

Stem-loop gma-MIR1520g


Accession
MI0016486
Description
Glycine max gma-MIR1520g precursor miRNA

Literature search
2 open access papers mention gma-MIR1520g
(2 sentences)

Sequence


augaugacugucacgugucauguucuaauugaaucuugaauccauggaagauaaaauacauuauuguuaucauugauCAAUCAGAACAUGACACGUGACAAucaucau
(((((((.((((((((((((((((((.(((((........((.((((..(((((......)))))....)))).))))))).)))))))))))))))))).)))))))

Structure
       c                  a     aucuugaa  c    --aa     aa 
augauga ugucacgugucauguucu auuga        uc augg    gauaa  u
||||||| |||||||||||||||||| |||||        || ||||    |||||   
uacuacu ACAGUGCACAGUACAAGA UAACu        ag uacu    uuauu  a
       A                  C     --------  u    auug     ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr12: 32708631-32708738 [-]

Database links

Mature gma-miR1520g

Accession MIMAT0018245
Description Glycine max gma-miR1520g mature miRNA
Sequence 78 - CAAUCAGAACAUGACACGUGACAA - 101
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14