miRBase entry: gma-MIR4361

Stem-loop gma-MIR4361


Accession
MI0016497
Description
Glycine max gma-MIR4361 precursor miRNA

Literature search
2 open access papers mention gma-MIR4361
(2 sentences)

Sequence


caaguugauccggaagucucuuacggaucaaguugauCCGGAAGAGACUUACGGAUCAACUua
.(((((((((((..(((((((..(((((((...)))))))..)))))))..))))))))))).

Structure
c           ga       ua       a 
 aaguugauccg  agucucu  cggauca  
 |||||||||||  |||||||  ||||||| g
 uUCAACUAGGC  UCAGAGA  GCCuagu  
a           AU       AG       u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr16: 15914012-15914074 [+]

Database links

Mature gma-miR4361

Accession MIMAT0018256
Description Glycine max gma-miR4361 mature miRNA
Sequence 38 - CCGGAAGAGACUUACGGAUCAACU - 61
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14