miRBase entry: gma-MIR4369

Stem-loop gma-MIR4369


Accession
MI0016511
Description
Glycine max gma-MIR4369 precursor miRNA

Literature search
2 open access papers mention gma-MIR4369
(4 sentences)

Sequence


uuuuccucuuucggaucaacuugauccggaagagacuuacggaucaacuuacGGAUCAAGCUGAUCCGGAAGUGGAaaa
.(((((.(((((((((((.(((((((((..((.((........))..))..))))))))).))))))))))).))))).

Structure
u     u           a         ga  -a  cuu 
 uuucc cuuucggauca cuugauccg  ag  ga   a
 ||||| ||||||||||| |||||||||  ||  ||    
 aaAGG GAAGGCCUAGU GAACUAGGc  uc  cu   c
a     U           C         au  aa  agg 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr7: 13628703-13628781 [-]

Database links

Mature gma-miR4369

Accession MIMAT0018270
Description Glycine max gma-miR4369 mature miRNA
Sequence 53 - GGAUCAAGCUGAUCCGGAAGUGGA - 76
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14