miRBase entry: gma-MIR4381

Stem-loop gma-MIR4381


Accession
MI0016529
Description
Glycine max gma-MIR4381 precursor miRNA


Sequence


cuugucaacguugacagucacaugucgcacuuuuauugaacauuauaugucacgauuuuauuagagguugacauuaauuaaguguacaaaaucaacguccaauaaaugcacgaUAUGUGACGGUAAACGGUGACAAGu
(((((((.((((.((.(((((((((((..(.(((((((.((((...)))).............((.(((((((((.....)))).......))))).))))))))).)..))))))))))).)).)))).))))))).

Structure
-       a    g  a           ca u       aacauuauaugucacgauuuuauua  g     -------    a 
 cuuguca cguu ac gucacaugucg  c uuuauug                         ga guuga       cauu a
 ||||||| |||| || |||||||||||  | |||||||                         || |||||       |||| u
 GAACAGU GCAA UG CAGUGUAUagc  g aaauaac                         cu caacu       guga u
u       G    A  G           ac u       -------------------------  g     aaaacau    a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 47293543-47293680 [-]

Database links

Mature gma-miR4381

Accession MIMAT0018288
Description Glycine max gma-miR4381 mature miRNA
Sequence 114 - UAUGUGACGGUAAACGGUGACAAG - 137
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14