We have generated a dot-bracket structure for each sequence using RNAfold.
Unambiguous secondary structure.
Parsed and ASCII art drawn.
Want the script? Email us or visit Downloads or something.
u u C U C CAc
gagugucacguuaucaugucu guca ugaCAU UCA UGUCAUGU AU c
||||||||||||||||||||| |||| |||||| ||| |||||||| ||
cucacagugUAGUAGUACGGA UAGU ACUGUA agu acagugca ua u
U C u u a acu