Stem-loop gma-MIR156f

Accession

MI0016559

Description

Glycine max gma-MIR156f precursor miRNA

Literature search

40 open access papers mention gma-MIR156f
(165 sentences)

Sequence

210874 reads, 913.0 reads per million, 176 experiments

auaucucaugUUGACAGAAGAGAGAGAGCACAacccgggaaugguuaaaggagucuuugccuuuguugggaguguGCUCUCUCUUCCUCUGUCAUcaucacauuca
.......(((.(((((((.(((((((((((((.(((((.((.(((.((((....))))))).)).)))))..)))))))))))))..))))))).)))........

Structure

-auaucuc   U       -A             -a     g  u   u    g 
        aug UGACAGA  GAGAGAGAGCACA  cccgg aa ggu aaag a
        ||| |||||||  |||||||||||||  ||||| || ||| ||||  
        uac ACUGUCU  UUCUCUCUCGugu  ggguu uu ccg uuuc g
acuuacac   U       CC             ga     g  u   -    u 

Annotation confidence High

Genome context

chr2: 47699715-47699820 [-]

Mature gma-miR156f-5p

• Accession: MIMAT0018318
• Description: Glycine max gma-miR156f-5p mature miRNA
• Sequence: 11 - UUGACAGAAGAGAGAGAGCACA - 32
• Evidence: experimental ; Illumina [1-3]

Mature gma-miR156f-3p

• Accession: MIMAT0054144
• Description: Glycine max gma-miR156f-3p mature miRNA
• Sequence: 76 - GCUCUCUCUUCCUCUGUCAU - 95
• Evidence: experimental ; unknown

References

1. PubMed ID: 20122185
   Prediction of novel miRNAs and associated target genes in Glycine max
   Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
   BMC Bioinformatics (2010) 11:S14


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


3. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153