miRBase entry: gma-MIR4403

Stem-loop gma-MIR4403


Accession
MI0016562
Description
Glycine max gma-MIR4403 precursor miRNA

Literature search
1 open access papers mention gma-MIR4403
(5 sentences)

Sequence


gacACGGACACCGAACACGACACGGACacggacacgugaauaccugucaaacacaucaaauucaacccggacacgggcgucgauguugugucggugucgguguc
(((((.((((((((.(((((((..(((...((((.((....)).)))).................((((....)))).)))..))))))))))))))).)))))

Structure
     G        A       CG   ---------------------------acg    c  g 
gacAC GACACCGA CACGACA  GAC                              gaca gu a
||||| |||||||| |||||||  |||                              |||| ||  
cugug cuguggcu guguugu  cug                              cugu ca a
     g        -       ag   cgggcacaggcccaacuuaaacuacacaaa    c  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 665909-666012 [+]

Database links

Mature gma-miR4403

Accession MIMAT0018321
Description Glycine max gma-miR4403 mature miRNA
Sequence 4 - ACGGACACCGAACACGACACGGAC - 27
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14