miRBase entry: gma-MIR4404

Stem-loop gma-MIR4404


Accession
MI0016564
Description
Glycine max gma-MIR4404 precursor miRNA


Sequence


aAUUCGUGGAAGACUGGCGGAUCAAcuuaauccgcacuugauucgcgagucuuucacggauc
.((((((((((((((.(((((((((............))))))))).)))))))))))))).

Structure
a              G         cuuaa 
 AUUCGUGGAAGACU GCGGAUCAA     u
 |||||||||||||| |||||||||      
 uaggcacuuucuga cgcuuaguu     c
c              g         cacgc 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr13: 20028554-20028615 [-]

Database links

Mature gma-miR4404

Accession MIMAT0018323
Description Glycine max gma-miR4404 mature miRNA
Sequence 2 - AUUCGUGGAAGACUGGCGGAUCAA - 25
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14