miRBase entry: gma-MIR4405

Stem-loop gma-MIR4405


Accession
MI0016565
Description
Glycine max gma-MIR4405 precursor miRNA


Sequence


cAUUCUAAGACGGUUAUCUGGGACCgucuuagaauguggcgcgguggcaaacuuguaauuaagauacucgaaauuucuuuuuacaacacacauuuuaagacgguugucaauaaccgucuuagaaua
.((((((((((((((((..(.(((((((((((((((((((......))....((((((..((((...........)))).))))))..))))))))))))))))).)..)))))))))))))))).

Structure
c                CU G                 gcgcgguggcaaac      uu    uacu 
 AUUCUAAGACGGUUAU  G GACCgucuuagaaugug              uuguaa  aaga    c
 ||||||||||||||||  | |||||||||||||||||              ||||||  ||||    g
 uaagauucugccaaua  u uuggcagaauuuuacac              aacauu  uucu    a
a                ac g                 ------------ac      -u    uuaa 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr6: 9334440-9334565 [+]

Database links

Mature gma-miR4405

Accession MIMAT0018324
Description Glycine max gma-miR4405 mature miRNA
Sequence 2 - AUUCUAAGACGGUUAUCUGGGACC - 25
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20122185
    Prediction of novel miRNAs and associated target genes in Glycine max
    Joshi T, Yan Z, Libault M, Jeong DH, Park S, Green PJ, Sherrier DJ, Farmer A, May G, Meyers BC, Xu D, Stacey G
    BMC Bioinformatics (2010) 11:S14