Stem-loop hsa-mir-548ac

Accession

MI0016762

Symbol

HGNC: MIR548AC

Description

Homo sapiens hsa-mir-548ac precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR548AC is a microRNA (miRNA) that has limited research on its role in immunological conditions [PMC10061723]. The presence of MIR548AC within the first intron of CD58 and the strong linkage between rs10801908 and rs1414273 might provide an incomplete picture of its effect [PMC10061723]. A study identified six candidate miR-SNPs, including MIR548AC, in the precursor, loop, and seed regions of four miRNAs [PMC10061723]. The study found that rs1414273 (MIR548AC) affects the transcription of CD58 and MIR548AC [PMC10061723'>PMC10061723'>PMC10061723'>PMC10061723'>PMC10061723'>PMC10061723]. This SNP is potentially associated with multiple sclerosis (MS) susceptibility and changes in MIR548AC stability [PMC10061723]. However, further prioritization of microRNA SNPs was not done due to a lack of predicted structural changes or high linkage disequilibrium in the major histocompatibility complex locus [PMC10061723]. The risk allele for rs1414273 is expected to result in higher levels of MIR548AC [PMC10061723]. Among other prioritized SNPs, rs1414273 (MIR548AC) was identified as a candidate MS SNP [PMC10061723]. Another SNP, rs2648841, was not among the prioritized effects outlined by the International Multiple Sclerosis Genetics Consortium (IMSGC) for MS susceptibility [PMC10061723]. Overall, this study highlights rs1414273 (MIR548AC) as a potential candidate MS SNP among other candidates identified through prioritization processes [PMC10061723].

Literature search

56 open access papers mention hsa-mir-548ac
(170 sentences)

Sequence

222 reads, 34 reads per million, 39 experiments

guauuagguuggugcaaaaguuauugugguuuuugcuauuuuuuuuuaauggCAAAAACCGGCAAUUACUUUUGcacuaaccuaguag
.((((((((((((((((((((.((((((((((((((((((.......))))))))))))).))))).)))))))))))))))))))).

Structure

g                    u     -             uu 
 uauuagguuggugcaaaagu auugu gguuuuugcuauu  u
 |||||||||||||||||||| ||||| |||||||||||||  u
 augauccaaucacGUUUUCA UAACG CCAAAAACgguaa  u
g                    U     G             uu 

Annotation confidence Not enough data

Genome context

chr1: 116560024-116560111 [-]

Disease association

hsa-mir-548ac is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-548ac

• Accession: MIMAT0018938
• Description: Homo sapiens hsa-miR-548ac mature miRNA
• Sequence: 53 - CAAAAACCGGCAAUUACUUUUG - 74
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127