MIR548AC is a microRNA (miRNA) that has limited research on its role in immunological conditions [PMC10061723]. The presence of MIR548AC within the first intron of CD58 and the strong linkage between rs10801908 and rs1414273 might provide an incomplete picture of its effect [PMC10061723]. A study identified six candidate miR-SNPs, including MIR548AC, in the precursor, loop, and seed regions of four miRNAs [PMC10061723]. The study found that rs1414273 (MIR548AC) affects the transcription of CD58 and MIR548AC [PMC10061723'>PMC10061723'>PMC10061723'>PMC10061723'>PMC10061723'>PMC10061723]. This SNP is potentially associated with multiple sclerosis (MS) susceptibility and changes in MIR548AC stability [PMC10061723]. However, further prioritization of microRNA SNPs was not done due to a lack of predicted structural changes or high linkage disequilibrium in the major histocompatibility complex locus [PMC10061723]. The risk allele for rs1414273 is expected to result in higher levels of MIR548AC [PMC10061723]. Among other prioritized SNPs, rs1414273 (MIR548AC) was identified as a candidate MS SNP [PMC10061723]. Another SNP, rs2648841, was not among the prioritized effects outlined by the International Multiple Sclerosis Genetics Consortium (IMSGC) for MS susceptibility [PMC10061723]. Overall, this study highlights rs1414273 (MIR548AC) as a potential candidate MS SNP among other candidates identified through prioritization processes [PMC10061723].
g u - uu uauuagguuggugcaaaagu auugu gguuuuugcuauu u |||||||||||||||||||| ||||| ||||||||||||| u augauccaaucacGUUUUCA UAACG CCAAAAACgguaa u g U G uu
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0018938 |
Description | Homo sapiens hsa-miR-548ac mature miRNA |
Sequence | 53 - CAAAAACCGGCAAUUACUUUUG - 74 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|