miRBase entry: hsa-mir-4429

Stem-loop hsa-mir-4429


Accession
MI0016768
Symbol
HGNC: MIR4429
Description
Homo sapiens hsa-mir-4429 precursor miRNA mir-4429
Gene
family?
RF03507; mir-4429

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR4429 is a microRNA implicated in various biological processes related to cancer. DNA methylation analysis has identified MIR4429 as one of the genes methylated in malignant struma ovarii, suggesting a role in tumor growth suppression [PMC10047136]. MIR4429 has been shown to target METTL3, which is involved in the m6A modification of SEC62 mRNA, leading to the destabilization of SEC62 mRNA and potentially inhibiting gastric cancer progression [PMC7272606], [PMC6920212]. In the context of non-small cell lung cancer (NSCLC), patients with lower levels of MIR4429 have been associated with poor overall survival, indicating its potential as a prognostic biomarker [PMC9392976]. Additionally, serum levels of MIR4429 have demonstrated diagnostic potential in distinguishing between patients with different EGFR mutation statuses [PMC9392976]. In stroke patients, altered levels of MIR4429 have been observed in peripheral blood mononuclear cells, suggesting its involvement beyond oncological disorders [PMC7123062]. Furthermore, genome-wide association studies have linked MIR4429 to endometriosis and high-grade serous ovarian cancer (HGSOC), indicating its relevance across various gynecological conditions [PMC9040176].

Literature search
2 open access papers mention hsa-mir-4429
(2 sentences)

Sequence

362 reads, 25 reads per million, 58 experiments
agggagAAAAGCUGGGCUGAGAGGCGacuggugucuaauuuguuugucucuccaacucagacugccuggccca
.(((.....(((((((..((((((((((.(((.....))).).)))))))))...))))).))......))).

Structure
a   -agAAA  -     -CU         - u   g 
 ggg      AG CUGGG   GAGAGGCGa c ggu u
 |||      || |||||   ||||||||| | ||| c
 ccc      uc gacuc   cucucuguu g uua u
a   gguccg  a     aac         u u   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 11540605-11540677 [-]

Disease association
hsa-mir-4429 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4429

Accession MIMAT0018944
Description Homo sapiens hsa-miR-4429 mature miRNA
Sequence 7 - AAAAGCUGGGCUGAGAGGCG - 26
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127