MIR4429 is a microRNA implicated in various biological processes related to cancer. DNA methylation analysis has identified MIR4429 as one of the genes methylated in malignant struma ovarii, suggesting a role in tumor growth suppression [PMC10047136]. MIR4429 has been shown to target METTL3, which is involved in the m6A modification of SEC62 mRNA, leading to the destabilization of SEC62 mRNA and potentially inhibiting gastric cancer progression [PMC7272606], [PMC6920212]. In the context of non-small cell lung cancer (NSCLC), patients with lower levels of MIR4429 have been associated with poor overall survival, indicating its potential as a prognostic biomarker [PMC9392976]. Additionally, serum levels of MIR4429 have demonstrated diagnostic potential in distinguishing between patients with different EGFR mutation statuses [PMC9392976]. In stroke patients, altered levels of MIR4429 have been observed in peripheral blood mononuclear cells, suggesting its involvement beyond oncological disorders [PMC7123062]. Furthermore, genome-wide association studies have linked MIR4429 to endometriosis and high-grade serous ovarian cancer (HGSOC), indicating its relevance across various gynecological conditions [PMC9040176].
a -agAAA - -CU - u g ggg AG CUGGG GAGAGGCGa c ggu u ||| || ||||| ||||||||| | ||| c ccc uc gacuc cucucuguu g uua u a gguccg a aac u u a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0018944 |
Description | Homo sapiens hsa-miR-4429 mature miRNA |
Sequence | 7 - AAAAGCUGGGCUGAGAGGCG - 26 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|