MIR4429 is a microRNA that has been found to be associated with tumor growth suppression and is detected in malignant struma ovarii [PMC10047136]. It has been suggested that MIR4429 targets METTL3 and prevents the m6A modification of SEC62 mRNA, leading to the destabilization of SEC62 mRNA [PMC7272606]. In patients with stroke, MIR4429 levels are lower in peripheral blood mononuclear cells, while in non-small cell lung cancer (NSCLC) patients, MIR4429 levels are significantly lower compared to healthy controls [PMC7123062] [PMC9392976]. NSCLC patients with low MIR4429 levels have been found to have poor overall survival [PMC9392976'>PMC9392976]. The expression levels of MIR4429 in circulation may be influenced by the VAS/SAT ratio and activity in adipose tissue [PMC6240145]. In genome-wide analyses, MIR4429 has been associated with endometriosis and various types of ovarian cancer (HGSOC, CCOC) [PMC9040176]. Additionally, it has been shown that MIR4429 inhibits gastric cancer progression by targeting METTL3 and hindering m6A-induced stabilization of SEC62 mRNA [PMC6920212]. References: - PMC10047136 - PMC7272606 - PMC7123062 - PMC9392976 - PMC6240145 - PMC9040176 - PMC6920212
a -agAAA - -CU - u g ggg AG CUGGG GAGAGGCGa c ggu u ||| || ||||| ||||||||| | ||| c ccc uc gacuc cucucuguu g uua u a gguccg a aac u u a
Disease | Description | Category | PubMed ID |
---|
Accession | MIMAT0018944 |
Description | Homo sapiens hsa-miR-4429 mature miRNA |
Sequence | 7 - AAAAGCUGGGCUGAGAGGCG - 26 |
Evidence |
experimental
Illumina [1] |
Database links |
![]() ![]() ![]() |
Predicted targets |
![]() ![]() ![]() |
|