miRBase entry: hsa-mir-4429

Stem-loop hsa-mir-4429


Accession
MI0016768
Symbol
HGNC: MIR4429
Description
Homo sapiens hsa-mir-4429 precursor miRNA mir-4429
Gene
family?
RF03507; mir-4429

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR4429 is a microRNA that has been found to be associated with tumor growth suppression and is detected in malignant struma ovarii [PMC10047136]. It has been suggested that MIR4429 targets METTL3 and prevents the m6A modification of SEC62 mRNA, leading to the destabilization of SEC62 mRNA [PMC7272606]. In patients with stroke, MIR4429 levels are lower in peripheral blood mononuclear cells, while in non-small cell lung cancer (NSCLC) patients, MIR4429 levels are significantly lower compared to healthy controls [PMC7123062] [PMC9392976]. NSCLC patients with low MIR4429 levels have been found to have poor overall survival [PMC9392976'>PMC9392976]. The expression levels of MIR4429 in circulation may be influenced by the VAS/SAT ratio and activity in adipose tissue [PMC6240145]. In genome-wide analyses, MIR4429 has been associated with endometriosis and various types of ovarian cancer (HGSOC, CCOC) [PMC9040176]. Additionally, it has been shown that MIR4429 inhibits gastric cancer progression by targeting METTL3 and hindering m6A-induced stabilization of SEC62 mRNA [PMC6920212].

References:
- PMC10047136
- PMC7272606
- PMC7123062
- PMC9392976
- PMC6240145
- PMC9040176
- PMC6920212

Literature search
2 open access papers mention hsa-mir-4429
(2 sentences)

Sequence

362 reads, 25 reads per million, 58 experiments
agggagAAAAGCUGGGCUGAGAGGCGacuggugucuaauuuguuugucucuccaacucagacugccuggccca
.(((.....(((((((..((((((((((.(((.....))).).)))))))))...))))).))......))).

Structure
a   -agAAA  -     -CU         - u   g 
 ggg      AG CUGGG   GAGAGGCGa c ggu u
 |||      || |||||   ||||||||| | ||| c
 ccc      uc gacuc   cucucuguu g uua u
a   gguccg  a     aac         u u   a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 11540605-11540677 [-]

Disease association
hsa-mir-4429 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4429

Accession MIMAT0018944
Description Homo sapiens hsa-miR-4429 mature miRNA
Sequence 7 - AAAAGCUGGGCUGAGAGGCG - 26
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127