miRBase entry: hsa-mir-4435-2

Stem-loop hsa-mir-4435-2


Accession
MI0016777
Symbol
HGNC: MIR4435-2
Description
Homo sapiens hsa-mir-4435-2 precursor miRNA mir-4435
Gene
family?
RF03576; mir-4435

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR4435-2 is a long noncoding RNA (lncRNA) that is located on human chromosome 2q13 and is known as MIR4435-2 host gene (MIR4435-2HG) [PMC8054316]. It has been identified as an oncogenic lncRNA that is implicated in various tumors, including ovarian cancer, colorectal cancer, gastric cancer, hepatocellular carcinoma, and head and neck squamous cell carcinoma [PMC8054316]. MIR4435-2HG has been found to recruit miRNAs to participate in tumor progression [PMC9208505]. It has also been reported to promote lung cancer progression by activating β-catenin signaling [PMC6861872]. MIR4435-2, which is hosted by MIR4435-2HG, has been considered a biomarker in various cancers such as oral squamous cell carcinoma [PMC7655182]. The function of MIR4435-2 is still unknown [PMC6732945]. The lncRNA AWPPH on chromosome 2 serves as the host gene for MIR4435-2 [PMC6732945]. AWPPH and TGF-β1 may interact with each other through the mediation of MIR4435-2 [PMC6732945]. The lncRNA CYTOR on chromosome 2p11.1 overlaps with miR4435-1 and MIR44352. These three genes have been identified through association testing for their significance in certain diseases or conditions such as hepatocellular carcinoma and poor prognosis of tumors [PMC7443120]

Literature search
8 open access papers mention hsa-mir-4435-2
(56 sentences)

Sequence

226 reads, 12 reads per million, 22 experiments
gcaaAUGGCCAGAGCUCACACAGAGGgaugagugcacuucaccugcagugugacucagcaggccaacagaugcu
(((..(((((.(((.((((((...(((.((((.....)))))))...)))))))))....))))).....))).

Structure
-   ---aA     ---A   C      AGA   a    u 
 gca     UGGCC    GAG UCACAC   GGg ugag g
 |||     |||||    ||| ||||||   ||| |||| c
 cgu     accgg    cuc agugug   ucc acuu a
u   agaca     acga   -      acg   -    c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 111321013-111321086 [-]

Disease association
hsa-mir-4435-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4435

Accession MIMAT0018951
Description Homo sapiens hsa-miR-4435 mature miRNA
Sequence 5 - AUGGCCAGAGCUCACACAGAGG - 26
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127