WARNING: This summary was generated by AI. MIR4435-2, a long noncoding RNA (lncRNA), is encoded by the MIR4435-2 host gene (MIR4435-2HG) located on chromosome 2q13, known by various names including LINC00978, AK001796, and AWPPH [PMC9205143]. This oncogenic lncRNA is associated with the progression and poor prognosis of several cancers such as ovarian, colorectal, gastric, and hepatocellular carcinoma [PMC8054316]. MIR4435-2HG has been implicated in tumor progression by recruiting miRNAs and activating pathways such as β-catenin signaling in lung cancer [PMC6861872]. Despite its established role as a biomarker in cancers like oral squamous cell carcinoma [PMC7655182], the specific function of MIR4435-2 itself remains to be fully elucidated [PMC6732945]. Research has suggested that MIR4435-2 may interact with AWPPH and TGF-β1; however, further studies are required to confirm this potential relationship [PMC6732945]. Additionally, MIR4435-2HG has been identified alongside other lncRNAs like HOTAIR and PVT1 in cancer studies but remains less studied compared to these well-established oncogenic lncRNAs [PMC7409010].
- ---aA ---A C AGA a u gca UGGCC GAG UCACAC GGg ugag g ||| ||||| ||| |||||| ||| |||| c cgu accgg cuc agugug ucc acuu a u agaca acga - acg - c
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0018951 |
| Description | Homo sapiens hsa-miR-4435 mature miRNA |
| Sequence | 5 - AUGGCCAGAGCUCACACAGAGG - 26 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|