Stem-loop hsa-mir-4435-2

Accession

MI0016777

Symbol

HGNC: MIR4435-2

Description

Homo sapiens hsa-mir-4435-2 precursor miRNA mir-4435

Gene
family

RF03576; mir-4435

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR4435-2 is a long noncoding RNA (lncRNA) that is located on human chromosome 2q13 and is known as MIR4435-2 host gene (MIR4435-2HG) [PMC8054316]. It has been identified as an oncogenic lncRNA that is implicated in various tumors, including ovarian cancer, colorectal cancer, gastric cancer, hepatocellular carcinoma, and head and neck squamous cell carcinoma [PMC8054316]. MIR4435-2HG has been found to recruit miRNAs to participate in tumor progression [PMC9208505]. It has also been reported to promote lung cancer progression by activating β-catenin signaling [PMC6861872]. MIR4435-2, which is hosted by MIR4435-2HG, has been considered a biomarker in various cancers such as oral squamous cell carcinoma [PMC7655182]. The function of MIR4435-2 is still unknown [PMC6732945]. The lncRNA AWPPH on chromosome 2 serves as the host gene for MIR4435-2 [PMC6732945]. AWPPH and TGF-β1 may interact with each other through the mediation of MIR4435-2 [PMC6732945]. The lncRNA CYTOR on chromosome 2p11.1 overlaps with miR4435-1 and MIR44352. These three genes have been identified through association testing for their significance in certain diseases or conditions such as hepatocellular carcinoma and poor prognosis of tumors [PMC7443120]

Literature search

8 open access papers mention hsa-mir-4435-2
(56 sentences)

Sequence

226 reads, 12 reads per million, 22 experiments

gcaaAUGGCCAGAGCUCACACAGAGGgaugagugcacuucaccugcagugugacucagcaggccaacagaugcu
(((..(((((.(((.((((((...(((.((((.....)))))))...)))))))))....))))).....))).

Structure

-   ---aA     ---A   C      AGA   a    u 
 gca     UGGCC    GAG UCACAC   GGg ugag g
 |||     |||||    ||| ||||||   ||| |||| c
 cgu     accgg    cuc agugug   ucc acuu a
u   agaca     acga   -      acg   -    c 

Annotation confidence Not enough data

Genome context

chr2: 111321013-111321086 [-]

Disease association

hsa-mir-4435-2 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-4435

• Accession: MIMAT0018951
• Description: Homo sapiens hsa-miR-4435 mature miRNA
• Sequence: 5 - AUGGCCAGAGCUCACACAGAGG - 26
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127