miRBase entry: hsa-mir-4435-2

Stem-loop hsa-mir-4435-2


Accession
MI0016777
Symbol
HGNC: MIR4435-2
Description
Homo sapiens hsa-mir-4435-2 precursor miRNA mir-4435
Gene
family?
RF03576; mir-4435

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR4435-2, a long noncoding RNA (lncRNA), is encoded by the MIR4435-2 host gene (MIR4435-2HG) located on chromosome 2q13, known by various names including LINC00978, AK001796, and AWPPH [PMC9205143]. This oncogenic lncRNA is associated with the progression and poor prognosis of several cancers such as ovarian, colorectal, gastric, and hepatocellular carcinoma [PMC8054316]. MIR4435-2HG has been implicated in tumor progression by recruiting miRNAs and activating pathways such as β-catenin signaling in lung cancer [PMC6861872]. Despite its established role as a biomarker in cancers like oral squamous cell carcinoma [PMC7655182], the specific function of MIR4435-2 itself remains to be fully elucidated [PMC6732945]. Research has suggested that MIR4435-2 may interact with AWPPH and TGF-β1; however, further studies are required to confirm this potential relationship [PMC6732945]. Additionally, MIR4435-2HG has been identified alongside other lncRNAs like HOTAIR and PVT1 in cancer studies but remains less studied compared to these well-established oncogenic lncRNAs [PMC7409010].

Literature search
8 open access papers mention hsa-mir-4435-2
(56 sentences)

Sequence

226 reads, 5 reads per million, 22 experiments
gcaaAUGGCCAGAGCUCACACAGAGGgaugagugcacuucaccugcagugugacucagcaggccaacagaugcu
(((..(((((.(((.((((((...(((.((((.....)))))))...)))))))))....))))).....))).

Structure
-   ---aA     ---A   C      AGA   a    u 
 gca     UGGCC    GAG UCACAC   GGg ugag g
 |||     |||||    ||| ||||||   ||| |||| c
 cgu     accgg    cuc agugug   ucc acuu a
u   agaca     acga   -      acg   -    c 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 111321013-111321086 [-]

Disease association
hsa-mir-4435-2 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4435

Accession MIMAT0018951
Description Homo sapiens hsa-miR-4435 mature miRNA
Sequence 5 - AUGGCCAGAGCUCACACAGAGG - 26
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127