MIR4454 is a microRNA that has been identified as overexpressed in ameloblastoma tumors, a type of benign but locally aggressive odontogenic neoplasm [PMC7920560][PMC5354851[PMC5354851]. The overexpression of MIR4454 has been associated with a reduction in tumor tissue and an increased sensitivity to chemotherapeutic agents such as 5FU, CPT11, and oxaliplatin [PMC7602903]. This suggests that MIR4454 may play a role in the cellular response to chemotherapy. Conversely, the downregulation of MIR4454 has been linked to drug resistance in colorectal cancer (CRC), indicating its potential as a therapeutic target for overcoming resistance [PMC7602903]. Additionally, there is evidence that the sequence of some hsa-miR-4454 reads may differ from its annotated genomic locus and instead match the sequence of tRNAHis, which could have implications for its biogenesis and function [PMC6675128]. The expression profile of MIR4454 has also been studied in hepatocellular carcinoma (HCC), further highlighting its relevance in cancer research [PMC7035418].
--cc A - GAGU - - aa
GG UC C CACGG CAC CA u
|| || | ||||| ||| || u
cc ag g gugcc gug gu u
acca - a aagu u c ac
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0018976 |
| Description | Homo sapiens hsa-miR-4454 mature miRNA |
| Sequence | 3 - GGAUCCGAGUCACGGCACCA - 22 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|