miRBase entry: hsa-mir-4454

Stem-loop hsa-mir-4454


Accession
MI0016800
Symbol
HGNC: MIR4454
Description
Homo sapiens hsa-mir-4454 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR4454 is a microRNA that has been identified as overexpressed in ameloblastoma tumors, a type of benign but locally aggressive odontogenic neoplasm [PMC7920560][PMC5354851[PMC5354851]. The overexpression of MIR4454 has been associated with a reduction in tumor tissue and an increased sensitivity to chemotherapeutic agents such as 5FU, CPT11, and oxaliplatin [PMC7602903]. This suggests that MIR4454 may play a role in the cellular response to chemotherapy. Conversely, the downregulation of MIR4454 has been linked to drug resistance in colorectal cancer (CRC), indicating its potential as a therapeutic target for overcoming resistance [PMC7602903]. Additionally, there is evidence that the sequence of some hsa-miR-4454 reads may differ from its annotated genomic locus and instead match the sequence of tRNAHis, which could have implications for its biogenesis and function [PMC6675128]. The expression profile of MIR4454 has also been studied in hepatocellular carcinoma (HCC), further highlighting its relevance in cancer research [PMC7035418].

Literature search
7 open access papers mention hsa-mir-4454
(21 sentences)

Sequence

25227 reads, 152 reads per million, 126 experiments
ccGGAUCCGAGUCACGGCACCAaauuucaugcguguccgugugaagagaccacca
..((.(((....((((((((((.......)).))).)))))....).))))....

Structure
--cc  A  - GAGU     -   -  aa 
    GG UC C    CACGG CAC CA  u
    || || |    ||||| ||| ||  u
    cc ag g    gugcc gug gu  u
acca  -  a aagu     u   c  ac 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr4: 163093574-163093628 [-]

Disease association
hsa-mir-4454 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4454

Accession MIMAT0018976
Description Homo sapiens hsa-miR-4454 mature miRNA
Sequence 3 - GGAUCCGAGUCACGGCACCA - 22
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127