Stem-loop hsa-mir-548ai

Accession

MI0016813

Symbol

HGNC: MIR548AI

Description

Homo sapiens hsa-mir-548ai precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR548AI is a member of the miR548 family and has been identified as a potential regulator of gene expression in diabetic kidney disease (DKD) [PMC8183707]. In a study investigating the role of MIR548AI in endothelial cell (EC) and smooth muscle cell (SMC) dysfunction, it was found that MIR548AI was upregulated in SMC-derived exosomes in response to cytokine stimulation [PMC8553949]. The study also revealed that transfection with a MIR548AI inhibitor improved EC growth and mitigated SMC proliferation, suggesting that MIR548AI may be a potential target for protecting ECs [PMC8553949]. Furthermore, the study found that the MIR548AI inhibitor protected against cytokine-induced EC dysfunction, both in the presence and absence of SMC-derived exosomes [PMC8553949]. The functional impact of MIR548AI on ECs and SMCs was also observed, with the inhibitor attenuating both EC dysfunction and SMC proliferation [PMC8553949'>PMC8553949]. Additionally, it was noted that little is known about MIR548AI in the literature, particularly its role in the vascular system [PMC8553949]. The study concluded that targeting MIR548AI may have translational significance for interventions aimed at preventing EC dysfunction induced by exosomes from dysfunctional SMCs [PMC8553949].

Literature search

56 open access papers mention hsa-mir-548ai
(170 sentences)

Sequence

217 reads, 31 reads per million, 53 experiments

guauuagguuggugcAAAGGUAAUUGCAGUUUUUCCCauuuaaaauauggaaaaaaaaaucacaauuacuuuugcaucaaccuaauaa
.(((((((((((((((((((((((((..((((((.((((.......))))....))))))..))))))))))))))))))))))))).

Structure

g                         CA      ---C    uu 
 uauuagguuggugcAAAGGUAAUUG  GUUUUU    CCau  a
 |||||||||||||||||||||||||  ||||||    ||||  a
 auaauccaacuacguuuucauuaac  uaaaaa    ggua  a
a                         ac      aaaa    ua 

Annotation confidence Not enough data

Genome context

chr6: 99124609-99124696 [+]

Disease association

hsa-mir-548ai is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-548ai

• Accession: MIMAT0018989
• Description: Homo sapiens hsa-miR-548ai mature miRNA
• Sequence: 16 - AAAGGUAAUUGCAGUUUUUCCC - 37
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127