miRBase entry: hsa-mir-548ai

Stem-loop hsa-mir-548ai


Accession
MI0016813
Symbol
HGNC: MIR548AI
Description
Homo sapiens hsa-mir-548ai precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

MIR548AI is a microRNA (miRNA) that has been identified as a key regulator in the pathogenesis of diabetic kidney disease (DKD) and has been implicated in the regulation of endothelial cell (EC) and smooth muscle cell (SMC) proliferation and dysfunction [PMC8183707]. It is one of the 18 miRNAs differentially expressed in DKD, suggesting its vital role in the disease [PMC8183707]. MIR548AI was found to be upregulated in SMC-derived exosomes following cytokine stimulation, which negatively impacts EC growth [PMC8553949]. However, transfection with a MIR548AI inhibitor can mitigate EC dysfunction induced by these exosomes and also reduce SMC proliferation, indicating its potential as an interventional target for EC protection [PMC8553949]. Despite its significant upregulation and functional importance, MIR548AI remains little-known within the literature, especially concerning its role within the vascular system [PMC8553949]. The findings suggest that antagonism of MIR548AI may offer a novel approach to prevent EC dysfunction caused by dysfunctional SMCs [PMC8553949]'>PMC8553949], providing new insights for potential therapeutic strategies targeting vascular complications associated with DKD [PMC8553949].

Literature search
56 open access papers mention hsa-mir-548ai
(170 sentences)

Sequence

207 reads, 3 reads per million, 50 experiments
guauuagguuggugcAAAGGUAAUUGCAGUUUUUCCCauuuaaaauauggaaaaaaaaaucacaauuacuuuugcaucaaccuaauaa
.(((((((((((((((((((((((((..((((((.((((.......))))....))))))..))))))))))))))))))))))))).

Structure
g                         CA      ---C    uu 
 uauuagguuggugcAAAGGUAAUUG  GUUUUU    CCau  a
 |||||||||||||||||||||||||  ||||||    ||||  a
 auaauccaacuacguuuucauuaac  uaaaaa    ggua  a
a                         ac      aaaa    ua 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr6: 99124609-99124696 [+]

Disease association
hsa-mir-548ai is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-548ai

Accession MIMAT0018989
Description Homo sapiens hsa-miR-548ai mature miRNA
Sequence 16 - AAAGGUAAUUGCAGUUUUUCCC - 37
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127