WARNING: This summary was generated by AI. MIR548AI is a microRNA (miRNA) that has been identified as a key regulator in the pathogenesis of diabetic kidney disease (DKD) and has been implicated in the regulation of endothelial cell (EC) and smooth muscle cell (SMC) proliferation and dysfunction [PMC8183707]. It is one of the 18 miRNAs differentially expressed in DKD, suggesting its vital role in the disease [PMC8183707]. MIR548AI was found to be upregulated in SMC-derived exosomes following cytokine stimulation, which negatively impacts EC growth [PMC8553949]. However, transfection with a MIR548AI inhibitor can mitigate EC dysfunction induced by these exosomes and also reduce SMC proliferation, indicating its potential as an interventional target for EC protection [PMC8553949]. Despite its significant upregulation and functional importance, MIR548AI remains little-known within the literature, especially concerning its role within the vascular system [PMC8553949]. The findings suggest that antagonism of MIR548AI may offer a novel approach to prevent EC dysfunction caused by dysfunctional SMCs [PMC8553949]'>PMC8553949], providing new insights for potential therapeutic strategies targeting vascular complications associated with DKD [PMC8553949].
g CA ---C uu uauuagguuggugcAAAGGUAAUUG GUUUUU CCau a ||||||||||||||||||||||||| |||||| |||| a auaauccaacuacguuuucauuaac uaaaaa ggua a a ac aaaa ua
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0018989 |
| Description | Homo sapiens hsa-miR-548ai-5p mature miRNA |
| Sequence | 16 - AAAGGUAAUUGCAGUUUUUCCC - 37 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|