miRBase entry: hsa-mir-4471

Stem-loop hsa-mir-4471


Accession
MI0016822
Symbol
HGNC: MIR4471
Description
Homo sapiens hsa-mir-4471 precursor miRNA


Sequence

14 reads, 0 reads per million, 11 experiments
ccaaauuuaaaacuuaaaccucuacuaaguuuccaugaaaagaacccaUGGGAACUUAGUAGAGGUUUAAguuuuaaauuuga
.((((((((((((((((((((((((((((((((((((.........)))))))))))))))))))))))))))))))))))).

Structure
c                                    aaa 
 caaauuuaaaacuuaaaccucuacuaaguuuccaug   a
 ||||||||||||||||||||||||||||||||||||   g
 guuuaaauuuugAAUUUGGAGAUGAUUCAAGGGUac   a
a                                    cca 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr8: 100382763-100382845 [+]

Database links

Mature hsa-miR-4471

Accession MIMAT0018998
Description Homo sapiens hsa-miR-4471 mature miRNA
Sequence 49 - UGGGAACUUAGUAGAGGUUUAA - 70
Evidence experimental
Illumina [1-2]

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127

  2. PubMed ID: 21199797
    Identification of new microRNAs in paired normal and tumor breast tissue suggests a dual role for the ERBB2/Her2 gene
    "Persson H, Kvist A, Rego N, Staaf J, Vallon-Christersson J, Luts L, Loman N, Jonsson G, Naya H, Hoglund M, Borg A, Rovira C"
    "Cancer Res (2011) 71:78-86