miRBase entry: hsa-mir-4511

Stem-loop hsa-mir-4511


Accession
MI0016877
Symbol
HGNC: MIR4511
Description
Homo sapiens hsa-mir-4511 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

Hsa-mir-4511 is a microRNA that has been observed to increase in expression in certain biological contexts. Specifically, it was among the most increased microRNAs in a study that measured levels of various miRs, indicating its potential biological significance [PMC8199419]. This miRNA was also identified as part of a miRNA-mRNA network related to muscle, suggesting its involvement in muscle-related regulatory processes [PMC8325595]. Moreover, hsa-mir-4511 has been found to target TLR1, which is involved in the innate immune response [PMC9526608]. In the context of lupus nephritis (LN), particularly class IV LN, hsa-mir-4511 expression was increased in the peripheral blood of patients [PMC9618628]. Additionally, a genetic variant known as rs34089864 has been shown to disrupt binding sites for hsa-mir-4511 and create new binding sites for other miRNAs [PMC5842303]. This alteration could potentially affect gene regulation and contribute to disease pathology. Lastly, hsa-mir-4511 is among several novel differentially abundant miRNAs identified in the plasma of patients with class IV lupus nephritis and could serve as a candidate for diagnostic biomarker development [PMC5685598].

Literature search
2 open access papers mention hsa-mir-4511
(3 sentences)

Sequence

131 reads, 17 reads per million, 29 experiments
aaaaaaaagggaaaGAAGAACUGUUGCAUUUGCCCUgcacucaguuugcacaggguaaaugcaauaguucuucuuucccuuuuuuua
.((((((((((((((((((((((((((((((((((((..(.......)..)))))))))))))))))))))))))))))))))))).

Structure
a                                    ca uc 
 aaaaaaagggaaaGAAGAACUGUUGCAUUUGCCCUg  c  a
 ||||||||||||||||||||||||||||||||||||  |  g
 uuuuuuucccuuucuucuugauaacguaaaugggac  g  u
a                                    ac uu 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr15: 65719246-65719332 [-]

Database links

Mature hsa-miR-4511

Accession MIMAT0019048
Description Homo sapiens hsa-miR-4511 mature miRNA
Sequence 15 - GAAGAACUGUUGCAUUUGCCCU - 36
Evidence experimental
Illumina [1-2], qPCR [2]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127

  2. PubMed ID: 21785231
    Detection of novel human MiRNAs responding to X-ray irradiation
    "Ding N, Wu X, He J, Chang L, Hu W, Li W, Wang J, Wang T, Zhou G"
    "J Radiat Res (2011) 52:425-432