Hsa-mir-4511 is a microRNA that has been studied in various contexts. In a study, it was found that hsa-mir-4511 had increased levels compared to other microRNAs [PMC8199419]. Another study identified hsa-mir-4511 as one of the three muscle-related microRNAs in a miRNA-mRNA network [PMC8325595]. Hsa-mir-4511 was also found to target TLR1, a gene involved in the immune response [PMC9526608]. In patients with class IV lupus nephritis, hsa-mir-4511 was found to be increased in peripheral blood [PMC9618628]. Additionally, a variant called rs34089864 was found to affect the binding sites of hsa-mir-4511 and create new binding sites for other microRNAs [PMC5842303]. Overall, hsa-mir-4511 is one of the 24 novel differentially abundant microRNAs identified in patients with class IV lupus nephritis and has potential as a diagnostic biomarker for this condition [PMC5685598].
a ca uc aaaaaaagggaaaGAAGAACUGUUGCAUUUGCCCUg c a |||||||||||||||||||||||||||||||||||| | g uuuuuuucccuuucuucuugauaacguaaaugggac g u a ac uu
Accession | MIMAT0019048 |
Description | Homo sapiens hsa-miR-4511 mature miRNA |
Sequence | 15 - GAAGAACUGUUGCAUUUGCCCU - 36 |
Evidence |
experimental
Illumina [1-2], qPCR [2] |
Database links | |
Predicted targets |
|