miRBase entry: hsa-mir-4516

Stem-loop hsa-mir-4516


Accession
MI0016882
Symbol
HGNC: MIR4516
Description
Homo sapiens hsa-mir-4516 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR4516 is a microRNA implicated in various physiological and pathological processes, including the progression of gastric cancer (GC) and the regulation of bone mineral density (BMD) in osteoporosis and osteopenia [PMC8305186; PMC5976644].'>PMC5976644].. It has been identified as a candidate-susceptible gene for autism spectrum disorder (ASD) [PMC9906952]. In GC, MIR4516 is known to interact with circRNA0047905, which reduces the inhibition of SERPINB5 and MMP11, thereby activating the Akt/CREB signaling pathway [PMC8305186]. In clinical samples, MIR4516 levels have been strongly associated with low BMD in osteoporosis and osteopenia patients who have experienced fractures; specifically, its levels were found to be decreased in the plasma of patients with osteoporosis compared to non-osteoporotic controls [PMC5976644]. Additionally, MIR4516 has been observed to increase in a resting CD4 T cell latency model treated with CCL19 and IL-7 but inhibiting it did not reverse latency [PMC7926981]. It is also reported to play a role in regulating epithelial barrier function within intestinal and airway epithelium [PMC9128841]. Despite its involvement in various conditions, MIR4516 was down-regulated along with other genes in certain gene expression studies [PMC8874170].

Literature search
29 open access papers mention hsa-mir-4516
(108 sentences)

Sequence

8196 reads, 46.0 reads per million, 174 experiments
AGGGAGAAGGGUCGGGGCagggagggcagggcaggcucugggguggggggucugugagucagcCACGGCUCUGCCCACGUCUCCCC
.((((((.(((.((((((.(((..(((...(((((((((.......)))))))))..)))..)).).)))))))))...)))))).

Structure
A      --A   U      a -  ag   agg         gg 
 GGGAGA   GGG CGGGGC g gg  ggc   gcaggcucu  g
 ||||||   ||| |||||| | ||  |||   |||||||||  g
 CCCUCU   CCC GUCUCG C Cc  cug   ugucugggg  u
C      GCA   -      G A  ga   -ag         gg 


Annotation confidence High
Do you think this miRNA is real?

Genome context
chr16: 2133119-2133204 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from hsa-mir-4516
Name Accession Chromosome Start End Strand Confidence




Disease association
hsa-mir-4516 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4516-5p

Accession MIMAT0019053
Description Homo sapiens hsa-miR-4516-5p mature miRNA
Sequence 1 - AGGGAGAAGGGUCGGGGC - 18
Evidence experimental
Illumina [1]
Database links
Predicted targets

Mature hsa-miR-4516-3p

Accession MIMAT0061383
Description Homo sapiens hsa-miR-4516-3p mature miRNA
Sequence 64 - CACGGCUCUGCCCACGUCUCCCC - 86
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127