WARNING: This summary was generated by AI. MIR4516 is a microRNA implicated in various physiological and pathological processes, including the progression of gastric cancer (GC) and the regulation of bone mineral density (BMD) in osteoporosis and osteopenia [PMC8305186; PMC5976644].'>PMC5976644].. It has been identified as a candidate-susceptible gene for autism spectrum disorder (ASD) [PMC9906952]. In GC, MIR4516 is known to interact with circRNA0047905, which reduces the inhibition of SERPINB5 and MMP11, thereby activating the Akt/CREB signaling pathway [PMC8305186]. In clinical samples, MIR4516 levels have been strongly associated with low BMD in osteoporosis and osteopenia patients who have experienced fractures; specifically, its levels were found to be decreased in the plasma of patients with osteoporosis compared to non-osteoporotic controls [PMC5976644]. Additionally, MIR4516 has been observed to increase in a resting CD4 T cell latency model treated with CCL19 and IL-7 but inhibiting it did not reverse latency [PMC7926981]. It is also reported to play a role in regulating epithelial barrier function within intestinal and airway epithelium [PMC9128841]. Despite its involvement in various conditions, MIR4516 was down-regulated along with other genes in certain gene expression studies [PMC8874170].
A --A U a - ag agg gg GGGAGA GGG CGGGGC g gg ggc gcaggcucu g |||||| ||| |||||| | || ||| ||||||||| g CCCUCU CCC GUCUCG C Cc cug ugucugggg u C GCA - G A ga -ag gg
| Name | Accession | Chromosome | Start | End | Strand | Confidence |
|---|
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0019053 |
| Description | Homo sapiens hsa-miR-4516-5p mature miRNA |
| Sequence | 1 - AGGGAGAAGGGUCGGGGC - 18 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
| Accession | MIMAT0061383 |
| Description | Homo sapiens hsa-miR-4516-3p mature miRNA |
| Sequence | 64 - CACGGCUCUGCCCACGUCUCCCC - 86 |
| Evidence |
experimental
Illumina [1] |
|