Stem-loop hsa-mir-4521

Accession

MI0016887

Symbol

HGNC: MIR4521

Description

Homo sapiens hsa-mir-4521 precursor miRNA

Summary

Caution, this is an AI generated summary based on literature. This may have errors.

MIR4521 is a miRNA whose validity has been questioned and is found in miRBase [PMC5340965]. It has been identified as one of the upregulated genes in early diabetic nephropathy (DN) [PMC7759603]. In a study on colorectal cancer, high levels of MIR4521 expression were associated with poor prognosis [PMC7583989]. MIR4521 is regulated by STAT3 and was found to be overexpressed in HT29-derived tumorspheres [PMC7583989]. In the context of diabetic kidney disease (DKD), MIR4521 was identified as one of the miRNAs that may regulate differentially expressed genes (DEGs) associated with DKD pathogenesis [PMC8183707]. Additionally, a study on transfection used a pre-miR-4521 sequence for transfection purposes [PMC6754377]. In summary, MIR4521 is a miRNA whose validity has been questioned and is found in miRBase. It has been implicated in early DN and colorectal cancer prognosis. It is regulated by STAT3 and may play a role in DKD pathogenesis. The pre-miR-4521 sequence has also been used for transfection purposes.

Literature search

3 open access papers mention hsa-mir-4521
(6 sentences)

Sequence

213980 reads, 2192 reads per million, 77 experiments

ucgGCUAAGGAAGUCCUGUGCUCAGuuuuguagcaucaaaacuaggauuucucuuguuac
..(((.(((((((((((......(((((((......))))))))))))))).))))))..

Structure

uc   U   -        GUGCUC       ua 
  gGC AAG GAAGUCCU      AGuuuug  g
  ||| ||| ||||||||      |||||||   
  uug uuc cuuuagga      ucaaaac  c
ca   -   u        ------       ua 

Annotation confidence Not enough data

Genome context

chr17: 8186945-8187004 [+]

Disease association

hsa-mir-4521 is associated with one or more human diseases in the Human microRNA Disease Database

Mature hsa-miR-4521

• Accession: MIMAT0019058
• Description: Homo sapiens hsa-miR-4521 mature miRNA
• Sequence: 4 - GCUAAGGAAGUCCUGUGCUCAG - 25
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 20733160
   Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
   "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
   "Blood (2010) 116:e118-e127