miRBase entry: hsa-mir-4521

Stem-loop hsa-mir-4521


Accession
MI0016887
Symbol
HGNC: MIR4521
Description
Homo sapiens hsa-mir-4521 precursor miRNA

Summary
Caution, this is an AI generated summary based on literature. This may have errors. ?

WARNING: This summary was generated by AI. MIR4521 is a microRNA whose validity has been questioned, yet it has been identified as significantly upregulated in early diabetic nephropathy (DN) [PMC5340965, PMC7759603].. The expression of MIR4521 has been manipulated in experimental settings using a pre-miRNA sequence [PMC6754377]. Studies have shown that high levels of MIR4521 expression correlate with poor prognoses, suggesting its potential role as a biomarker [PMC7583989]. Additionally, MIR4521 is one of the microRNAs regulated by STAT3 that is overexpressed in HT29-derived tumorspheres, which are a model for cancer stem cells [PMC7583989]. In the context of diabetic kidney disease (DKD), MIR4521 is among the miRNAs identified as having vital roles in the disease's pathogenesis [PMC8183707].

Literature search
3 open access papers mention hsa-mir-4521
(6 sentences)

Sequence

213980 reads, 1151 reads per million, 77 experiments
ucgGCUAAGGAAGUCCUGUGCUCAGuuuuguagcaucaaaacuaggauuucucuuguuac
..(((.(((((((((((......(((((((......))))))))))))))).))))))..

Structure
uc   U   -        GUGCUC       ua 
  gGC AAG GAAGUCCU      AGuuuug  g
  ||| ||| ||||||||      |||||||   
  uug uuc cuuuagga      ucaaaac  c
ca   -   u        ------       ua 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr17: 8186945-8187004 [+]

Disease association
hsa-mir-4521 is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-4521

Accession MIMAT0019058
Description Homo sapiens hsa-miR-4521 mature miRNA
Sequence 4 - GCUAAGGAAGUCCUGUGCUCAG - 25
Evidence experimental
Illumina [1]
Database links
Predicted targets

References

  1. PubMed ID: 20733160
    Deep sequencing of the small RNA transcriptome of normal and malignant human B cells identifies hundreds of novel microRNAs
    "Jima DD, Zhang J, Jacobs C, Richards KL, Dunphy CH, Choi WW, Au WY, Srivastava G, Czader MB, Rizzieri DA, Lagoo AS, Lugar PL, Mann KP, Flowers CR, Bernal-Mizrachi L, Naresh KN, Evens AM, Gordon LI, Luftig M, Friedman DR, Weinberg JB, Thompson MA, Gill JI,"
    "Blood (2010) 116:e118-e127