MIR4521 is a microRNA whose validity has been questioned, yet it has been identified as significantly upregulated in early diabetic nephropathy (DN) [PMC5340965, PMC7759603].. The expression of MIR4521 has been manipulated in experimental settings using a pre-miRNA sequence [PMC6754377]. Studies have shown that high levels of MIR4521 expression correlate with poor prognoses, suggesting its potential role as a biomarker [PMC7583989]. Additionally, MIR4521 is one of the microRNAs regulated by STAT3 that is overexpressed in HT29-derived tumorspheres, which are a model for cancer stem cells [PMC7583989]. In the context of diabetic kidney disease (DKD), MIR4521 is among the miRNAs identified as having vital roles in the disease's pathogenesis [PMC8183707].
uc U - GUGCUC ua gGC AAG GAAGUCCU AGuuuug g ||| ||| |||||||| ||||||| uug uuc cuuuagga ucaaaac c ca - u ------ ua
| Disease | Description | Category | PubMed ID |
|---|
| Accession | MIMAT0019058 |
| Description | Homo sapiens hsa-miR-4521 mature miRNA |
| Sequence | 4 - GCUAAGGAAGUCCUGUGCUCAG - 25 |
| Evidence |
experimental
Illumina [1] |
| Database links |
|
| Predicted targets |
|
|