miRBase entry: gma-MIR1508c

Stem-loop gma-MIR1508c


Accession
MI0017855
Description
Glycine max gma-MIR1508c precursor miRNA

Literature search
8 open access papers mention gma-MIR1508c
(18 sentences)

Sequence


cuacucaacugcuauuuuccuuuuugaaccuuguuaccuugagcaucuugaucaauuguuUAGAAAGGGAAAUAGCAGUUGaguagugcu
(((((((((((((((((((((((((((((.(((...................)))..)))))))))))))))))))))))))))))....

Structure
----                             -c   uuaccuug 
    cuacucaacugcuauuuuccuuuuugaac  uug        a
    |||||||||||||||||||||||||||||  |||        g
    gaugaGUUGACGAUAAAGGGAAAGAUuug  aac        c
ucgu                             uu   uaguucua 


Annotation confidence Low
Do you think this miRNA is real?

Genome context
chr9: 31140427-31140516 [+]

Database links


References

  1. PubMed ID: 21504877
    MicroRNAs in the shoot apical meristem of soybean
    "Wong CE, Zhao YT, Wang XJ, Croft L, Wang ZH, Haerizadeh F, Mattick JS, Singh MB, Carroll BJ, Bhalla PL"
    "J Exp Bot (2011) 62:2495-2506

  2. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553