miRBase entry: bdi-MIR5057

Stem-loop bdi-MIR5057


Accession
MI0017947
Description
Brachypodium distachyon bdi-MIR5057 precursor miRNA


Sequence


uggcacagccaAAAUUUCAAAUCAUUUUGACAaaguuaacuugcucaaauucaugguuuaaauuugaaaaacugua
((((...))))((((((.((((((((((((..(((....)))..)))))...)))))))))))))...........

Structure
uggcacagcca      C       ---     CA   u 
           AAAUUU AAAUCAU   UUUGA  aag u
           |||||| |||||||   |||||  |||  
           uuuaaa uuuggua   aaacu  uuc a
augucaaaaag      -       cuu     cg   a 


Annotation confidence Not enough data
Do you think this miRNA is real?
Comments
This is a predicted homolog of a miRNA identified by Illumina deep sequencing in barley (Hordeum vulgare) [1].

Genome context
4: 10594352-10594427 [+]

Database links

Mature bdi-miR5057

Accession MIMAT0020556
Description Brachypodium distachyon bdi-miR5057 mature miRNA
Sequence 12 - AAAUUUCAAAUCAUUUUGACA - 32
Evidence not_experimental

References

  1. PubMed ID: 21352554
    Discovery of barley miRNAs through deep sequencing of short reads
    Schreiber AW, Shi BJ, Huang CY, Langridge P, Baumann U
    BMC Genomics (2011) 12:129