miRBase entry: bdi-MIR394

Stem-loop bdi-MIR394


Accession
MI0018115
Description
Brachypodium distachyon bdi-MIR394 precursor miRNA

Literature search
1 open access papers mention bdi-MIR394
(1 sentences)

Sequence


gcaguaguaauagucauguggguuugccaaaggggcgcuuaccgagagcucuUUGGCAUUCUGUCCACCUCCuugcgagucucgcgggagaucucaugaucuguuguugagcuugcagauagcuuggaggugggcauacugccaauggagcuguguaggcuucccuuuguaaaacccauauggcgaagaucaaaccagcu
............(((((((((((((..((((((((.((((((..(.((((((((((((...((((((((((((((((((.(((((((.(((((....))))).))).))))))))))).......)))))))))))...)))))).)))))).))))))).))))))))..)))))))))))))................

Structure
----gcaguaguaaua             gc        c      cg g      -      UUC           -------       u    -   g     u 
                gucauguggguuu  caaagggg gcuuac  a agcucu UUGGCA   UGUCCACCUCC       uugcgag cucg cgg agauc c
                |||||||||||||  |||||||| ||||||  | |||||| ||||||   |||||||||||       ||||||| |||| ||| |||||  
                cgguauacccaaa  guuucccu cggaug  u ucgagg aaccgu   acggguggagg       gacguuc gagu guu ucuag a
ucgaccaaacuagaag             au        u      -- g      u      cau           uucgaua       -    u   g     u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
3: 52316372-52316571 [-]

Database links

Mature bdi-miR394

Accession MIMAT0020690
Description Brachypodium distachyon bdi-miR394 mature miRNA
Sequence 53 - UUGGCAUUCUGUCCACCUCC - 72
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 21371551
    Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs
    "Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G"
    "Genomics (2011) 97:282-293

  2. PubMed ID: 19772667
    Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response
    Zhang J, Xu Y, Huan Q, Chong K
    BMC Genomics (2009) 10:449