Stem-loop bdi-MIR156d

Accession

MI0018122

Description

Brachypodium distachyon bdi-MIR156d precursor miRNA

Literature search

5 open access papers mention bdi-MIR156d
(26 sentences)

Sequence

gccggccggcagggucaugugugcgcgcggUGACAGAAGAGAGUGAGCACacggccgggcgggacggcacccggcggauuggugccgucgcggccgcguGCUCACUGCUCUGUCUGUCACCuuugcccagaaggccgccucuucacggaca
..(((((..(.((((...(((....)))((((((((((((((((((((((.(((((....(.(((((((((.........))))))))).)))))).))))))))).)))).)))))))))...)))).)..)))))..............

Structure

------------gc     gg a    caugugugcgcgc         -    -         a     gggc g         cgg 
              cggcc  c gggu             ggUGACAGA AGAG AGUGAGCAC cggcc    g gacggcacc   c
              |||||  | ||||             ||||||||| |||| ||||||||| |||||    | |||||||||   g
              gccgg  g cccg             CCACUGUCU UCUC UCACUCGug gccgg    c cugccgugg   g
acaggcacuucucc     aa a    ----------uuu         G    G         c     ---- g         uua 

Annotation confidence Not enough data

Genome context

5: 18202182-18202332 [-]

Mature bdi-miR156d-5p

• Accession: MIMAT0020697
• Description: Brachypodium distachyon bdi-miR156d-5p mature miRNA
• Sequence: 31 - UGACAGAAGAGAGUGAGCAC - 50
• Evidence: experimental ; Illumina [2]

Mature bdi-miR156d-3p

• Accession: MIMAT0027069
• Description: Brachypodium distachyon bdi-miR156d-3p mature miRNA
• Sequence: 100 - GCUCACUGCUCUGUCUGUCACC - 121
• Evidence: experimental ; Illumina [2]

References

1. PubMed ID: 21371551
   Implementation of a de novo genome-wide computational approach for updating Brachypodium miRNAs
   "Baev V, Milev I, Naydenov M, Apostolova E, Minkov G, Minkov I, Yahubyan G"
   "Genomics (2011) 97:282-293


2. PubMed ID: 23264558
   Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon
   "Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E"
   "Mol Plant (2013) 6:423-443