miRBase entry: bdi-MIR395j

Stem-loop bdi-MIR395j


Accession
MI0018224
Description
Brachypodium distachyon bdi-MIR395j precursor miRNA

Literature search
3 open access papers mention bdi-MIR395j
(32 sentences)

Sequence


gguauucucaugaGUUUCCCGCAAGCACUUCACGaggccguuuucugagggcuacugUGAAGUGUUUGGGGGAACUCuuggucucacc
(((....(((.(((((((((.(((((((((((((.((((.((....)).))))..)))))))))))))))))))))).)))....)))

Structure
   auuc   u         G             -a    g  u 
ggu    uca gaGUUUCCC CAAGCACUUCACG  ggcc uu u
|||    ||| ||||||||| |||||||||||||  |||| ||  
cca    ggu CUCAAGGGG GUUUGUGAAGUgu  ucgg ag c
   cucu   u         -             ca    g  u 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
5: 25456151-25456238 [+]
Clustered miRNAs
10 other miRNAs are < 10 kb from bdi-MIR395j
Name Accession Chromosome Start End Strand Confidence




Database links

Mature bdi-miR395j-3p

Accession MIMAT0020749
Description Brachypodium distachyon bdi-miR395j-3p mature miRNA
Sequence 58 - UGAAGUGUUUGGGGGAACUC - 77
Evidence experimental
Illumina [1-2]

Mature bdi-miR395j-5p

Accession MIMAT0027093
Description Brachypodium distachyon bdi-miR395j-5p mature miRNA
Sequence 14 - GUUUCCCGCAAGCACUUCACG - 34
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 19772667
    Deep sequencing of Brachypodium small RNAs at the global genome level identifies microRNAs involved in cold stress response
    Zhang J, Xu Y, Huan Q, Chong K
    BMC Genomics (2009) 10:449

  2. PubMed ID: 23264558
    Addressing the role of microRNAs in reprogramming leaf growth during drought stress in Brachypodium distachyon
    "Bertolini E, Verelst W, Horner DS, Gianfranceschi L, Piccolo V, Inze D, Pe ME, Mica E"
    "Mol Plant (2013) 6:423-443