Stem-loop gma-MIR5368

Accession

MI0018621

Description

Glycine max gma-MIR5368 precursor miRNA

Literature search

2 open access papers mention gma-MIR5368
(7 sentences)

Sequence

2778038 reads, 5280.0 reads per million, 177 experiments

acuGUUUCCUGGGAUUGGCUUugggcuuuccugcacagcuuagguggagggcaaagaagacuuccuucugagggggccagagccaucagagagauaccacucuggacgagcuagaauucuaaccuugugccaggaccuaugggccgagGGACAGUCUCAGGUAGACAgu
(((((((((((((((((.((((.(((((((((((((((((((((.(((((..........))))).))))))..(((....)))..(((((........))))).......(((....)))...))))).))))).....))))).)))).)))))))))).)))))))

Structure

       -          G    g     -----     -     ----------------------------------------------------      u     gcaa 
acuGUUU CCUGGGAUUG CUUu ggcuu     uccug cacag                                                    cuuagg ggagg    a
||||||| |||||||||| |||| |||||     ||||| |||||                                                    |||||| |||||     
ugACAGA GGACUCUGAC GGga ccggg     aggac guguu                                                    gagucu ccuuc    g
       U          A    g     uaucc     c     ccaaucuuaagaucgagcaggucucaccauagagagacuaccgagaccgggg      u     agaa 

Annotation confidence Low

Genome context

chr4: 23728083-23728251 [+]

Mature gma-miR5368-5p

• Accession: MIMAT0054219
• Description: Glycine max gma-miR5368-5p mature miRNA
• Sequence: 4 - GUUUCCUGGGAUUGGCUU - 21
• Evidence: experimental ; unknown

Mature gma-miR5368-3p

• Accession: MIMAT0021602
• Description: Glycine max gma-miR5368-3p mature miRNA
• Sequence: 149 - GGACAGUCUCAGGUAGACA - 167
• Evidence: experimental ; Illumina [1]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307