Stem-loop gma-MIR319h

Accession

MI0018673

Description

Glycine max gma-MIR319h precursor miRNA

Literature search

17 open access papers mention gma-MIR319h
(42 sentences)

Sequence

aguugaagagagcuuccuucaguccacucauggaugggaaagggguuugaauuagcugcugacucauucauucaaacacaauagauucggcuucaugauauguuauugugaaugugugaaugaugcgggagguaaauuucuuccuuuucuuguccuugcUUGGACUGAAGGGAGCUCCCUcuaacu
(((((.((.(((((((((((((((((..((.((((((((((((((...((.(((.((.(((..((((((((.((..((((((((..(((......)))....))))))))..)).))))))))..))).)).))).))...)))))))))))))).))..))))))))))))))))).)).)))))

Structure

     a  a                 cu  u              uuu  a   g  g   ac        u  aa        --au   gc 
aguug ag gagcuuccuucagucca  ca ggaugggaaagggg   ga uua cu cug  ucauucau ca  cacaauag    ucg  u
||||| || |||||||||||||||||  || ||||||||||||||   || ||| || |||  |||||||| ||  ||||||||    |||   
ucaau UC CUCGAGGGAAGUCAGGU  gu ccuguucuuuuccu   uu aau ga ggc  aguaagug gu  guguuauu    agu  u
     c  C                 Uc  u              ucu  a   g  g   gu        u  aa        guau   ac 

Annotation confidence Not enough data

Genome context

chr2: 42629369-42629554 [+]

Mature gma-miR319h

• Accession: MIMAT0021662
• Description: Glycine max gma-miR319h mature miRNA
• Sequence: 160 - UUGGACUGAAGGGAGCUCCCU - 180
• Evidence: experimental ; Illumina [1-3]

References

1. PubMed ID: 21663675
   Identification of novel soybean microRNAs involved in abiotic and biotic stresses
   Kulcheski FR, de Oliveira LF, Molina LG, Almerão MP, Rodrigues FA, Marcolino J, Barbosa JF, Stolf-Moreira R, Nepomuceno AL, Marcelino-Guimarães FC, Abdelnoor RV, Nascimento LC, Carazzolle MF, Pereira GA, Margis R
   BMC Genomics (2011) 12:307


2. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


3. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153