miRBase entry: mtr-MIR168c

Stem-loop mtr-MIR168c


Accession
MI0019093
Description
Medicago truncatula mtr-MIR168c precursor miRNA

Literature search
5 open access papers mention mtr-MIR168c
(20 sentences)

Sequence


cucacuucgcggucucuaauUCGCUUGGUGCAGGUCGGGAAccacuacauccgcuguuuucguagaaaccggcggugaauuggauCCCGCCUUGCAUCAACUGAAUcggaggccgcggugaaucua
.((((..((((((((((.(((((.((((((((((.(((((.(((...((.((((((.((((...)))).))))))))...))).))))).)))))))))).))))).)))))))))))))).....

Structure
----c    uu          a     C          U     A   cua  u      u    g 
     ucac  cgcggucucu auUCG UUGGUGCAGG CGGGA cca   ca ccgcug uuuc  
     ||||  |||||||||| ||||| |||||||||| ||||| |||   || |||||| |||| u
     agug  gcgccggagg UAAGU AACUACGUUC GCCCu ggu   gu ggcggc aaag  
aucua    --          c     C          C     a   uaa  -      c    a 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr5: 10278669-10278794 [+]
Clustered miRNAs
1 other miRNA is < 10 kb from mtr-MIR168c
Name Accession Chromosome Start End Strand Confidence




Database links

Mature mtr-miR168c-5p

Accession MIMAT0022235
Description Medicago truncatula mtr-miR168c-5p mature miRNA
Sequence 21 - UCGCUUGGUGCAGGUCGGGAA - 41
Evidence experimental
Illumina [1-2]

Mature mtr-miR168c-3p

Accession MIMAT0022236
Description Medicago truncatula mtr-miR168c-3p mature miRNA
Sequence 86 - CCCGCCUUGCAUCAACUGAAU - 106
Evidence experimental
Illumina [1]

References

  1. PubMed ID: 21762498
    Identification of drought-responsive microRNAs in Medicago truncatula by genome-wide high-throughput sequencing
    Wang T, Chen L, Zhao M, Tian Q, Zhang WH
    BMC Genomics (2011) 12:367

  2. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553