miRBase entry: hsa-mir-664b

Stem-loop hsa-mir-664b


Accession
MI0019134
Symbol
HGNC: MIR664B
Description
Homo sapiens hsa-mir-664b precursor miRNA

Literature search
30 open access papers mention hsa-mir-664b
(95 sentences)

Sequence

2641 reads, 13 reads per million, 85 experiments
UGGGCUAAGGGAGAUGAUUGGGUAgaaaguauuauucuaUUCAUUUGCCUCCCAGCCUACA
((((((..(((((.(((.(((((((((.......))))))))).))).)))))))))))..

Structure
--      AA     A   U         ag 
  UGGGCU  GGGAG UGA UGGGUAgaa  u
  ||||||  ||||| ||| |||||||||  a
  AUCCGA  CCCUC GUU ACUUaucuu  u
AC      --     C   U         au 


Annotation confidence Medium
Do you think this miRNA is real?

Genome context
chrX: 154768596-154768656 [+]

Disease association
hsa-mir-664b is associated with one or more human diseases in the Human microRNA Disease Database
Disease Description Category PubMed ID


Database links

Mature hsa-miR-664b-5p

Accession MIMAT0022271
Description Homo sapiens hsa-miR-664b-5p mature miRNA
Sequence 1 - UGGGCUAAGGGAGAUGAUUGGGUA - 24
Evidence not_experimental
Database links
Predicted targets

Mature hsa-miR-664b-3p

Accession MIMAT0022272
Description Homo sapiens hsa-miR-664b-3p mature miRNA
Sequence 40 - UUCAUUUGCCUCCCAGCCUACA - 61
Evidence not_experimental
Database links
Predicted targets

References

  1. PubMed ID: 21911355
    miRDeep2 accurately identifies known and hundreds of novel microRNA genes in seven animal clades
    "Friedlander MR, Mackowiak SD, Li N, Chen W, Rajewsky N"
    "Nucleic Acids Res (2012) 40:37-52