We have generated a dot-bracket structure for each sequence using RNAfold.
Unambiguous secondary structure.
Parsed and ASCII art drawn.
Want the script? Email us or visit Downloads or something.
u uc a u c c uc
auuuuacacaugcauccaaugauguguu cac uca uugau aauauga aac g
|||||||||||||||||||||||||||| ||| ||| ||||| ||||||| |||
uaaaauguguACGUAGGUUACUACACAA GUG agu aauua uuauacu uug u
- CA C u u u ug