miRBase entry: gma-MIR4416c

Stem-loop gma-MIR4416c


Accession
MI0019717
Description
Glycine max gma-MIR4416c precursor miRNA

Literature search
3 open access papers mention gma-MIR4416c
(5 sentences)

Sequence


ucauuuuucuguggucacuucugcuCUGGGUGAGAGAAACACGUAUugaagaagguucauggcuuagacaauaaguugcuacuuugcugaacucaccauuuuaugugaagaaguggcuaugcuaauuguuugauucuguacacguacgauACGGGUCGCUCUCACCUGGAGuagggcugcccaaagcuuugauaaa
(((.....((.(((.((.((((((((((((((((((..((.(((((((......((.((.((.(((((((((.(((.((((((((.......((((........)))).))))))))...))).))))))))).)))).)).....))))))).))..)))))))))))))))))).)).))).))...)))....

Structure
----   uuuuu  g   u  c                  AA  A       aagaag  u  u  c         a   --u        gcugaac    cau 
    uca     cu ugg ca uucugcuCUGGGUGAGAG  AC CGUAUug      gu ca gg uuagacaau agu   gcuacuuu       ucac   u
    |||     || ||| || ||||||||||||||||||  || |||||||      || || || ||||||||| |||   ||||||||       ||||    
    agu     ga acc gu gggauGAGGUCCACUCUC  UG GCAuagc      ca gu cu aguuuguua ucg   cggugaag       agug   u
aaau   --uuc  a   c  c                  GC  G       -augca  u  -  u         a   uau        ------a    uau 


Annotation confidence Not enough data
Do you think this miRNA is real?

Genome context
chr2: 27334573-27334768 [-]

Database links

Mature gma-miR4416c-5p

Accession MIMAT0023172
Description Glycine max gma-miR4416c-5p mature miRNA
Sequence 26 - CUGGGUGAGAGAAACACGUAU - 46
Evidence experimental
Illumina [1]

Mature gma-miR4416c-3p

Accession MIMAT0037453
Description Glycine max gma-miR4416c-3p mature miRNA
Sequence 151 - ACGGGUCGCUCUCACCUGGAG - 171
Evidence experimental
Illumina [2]

References

  1. PubMed ID: 22156213
    MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
    "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
    "Genes Dev (2011) 25:2540-2553

  2. PubMed ID: 25747880
    Evolutionary patterns and coevolutionary consequences of MIRNA genes and microRNA targets triggered by multiple mechanisms of genomic duplications in soybean
    "Zhao M, Meyers BC, Cai C, Xu W, Ma J"
    "Plant Cell (2015) 27:546-562