Stem-loop gma-MIR399h

Accession

MI0019796

Description

Glycine max gma-MIR399h precursor miRNA

Literature search

15 open access papers mention gma-MIR399h
(87 sentences)

Sequence

caaaucagcaauagggcaccucucuccuggcaggagaaaaagaucagcauuuuuggaguuaccaaaagucagugucaauaacuUGCCAAAGGAGAGUUGCCCUGuggcugguuu
.((((((((.((((((((.((((((..(((((((.......(((....((((((((.....))))))))....))).....)))))))..)))))).)))))))).))))))))

Structure

c        a        c      cc       agaaaaa   cagc        a 
 aaaucagc auagggca cucucu  uggcagg       gau    auuuuugg g
 |||||||| |||||||| ||||||  |||||||       |||    |||||||| u
 uuuggucg uGUCCCGU GAGAGG  ACCGUuc       cug    ugaaaacc u
-        g        U      AA       --aauaa   ugac        a 

Annotation confidence Not enough data

Genome context

chr9: 36742439-36742552 [+]

Clustered miRNAs

1 other miRNA is < 10 kb from gma-MIR399h

Mature gma-miR399h

• Accession: MIMAT0023251
• Description: Glycine max gma-miR399h mature miRNA
• Sequence: 84 - UGCCAAAGGAGAGUUGCCCUG - 104
• Evidence: experimental ; Illumina [1-2]

References

1. PubMed ID: 22156213
   MicroRNAs as master regulators of the plant NB-LRR defense gene family via the production of phased, trans-acting siRNAs
   "Zhai J, Jeong DH, De Paoli E, Park S, Rosen BD, Li Y, Gonzalez AJ, Yan Z, Kitto SL, Grusak MA, Jackson SA, Stacey G, Cook DR, Green PJ, Sherrier DJ, Meyers BC"
   "Genes Dev (2011) 25:2540-2553


2. PubMed ID: 24475082
   Systems and evolutionary characterization of microRNAs and their underlying regulatory networks in soybean cotyledons
   Goettel W, Liu Z, Xia J, Zhang W, Zhao PX, An YQ
   PLoS One (2014) 9:e86153